/ࡱ> J M 5 6 7 8 9 : ; < = > ? @ A B C D E F G H I c  bjbj ؎U\؎U\' LLL````|T`\TlI6I6I6SSSSSSS$V~YbTLI6s5I6I6I6TT666I6LS6I6S66::@6?;к_6: S,T0\T:RYu6pY?;YL?;I6I66I6I6I6I6I6TT6I6I6I6\TI6I6I6I6YI6I6I6I6I6I6I6I6I6 J V:   Dlivr par ETABLISSEMENT Prpare au sein de lcole doctorale XXXXXXXXXXXX Et de lunit de recherche XXXXXXXXXXX Spcialit: XXXXXXXXXXXXXX Prsente parXXXXXXXXXXXXXXXXXXX  Soutenue le XXXXXXXXXXXXXX devant le jury compos de  Civilit Prnom NOM, Grade, EtablissementStatut JuryCivilit Prnom NOM, Grade, EtablissementStatut JuryCivilit Prnom NOM, Grade, EtablissementStatut JuryCivilit Prnom NOM, Grade, EtablissementStatut JuryCivilit Prnom NOM, Grade, EtablissementStatut Jury TITRE DE LA THESE  INCLUDEPICTURE "http://www.univ-montp3.fr/images/stories/communication/img/Logo_NOIR_VF.jpg" \* MERGEFORMATINET  Logo ETABLISSEMENT  "#$%&.KLXYtŻ촧Œ}ŒŻmf_X h!{hS3 h*_hS3 hh3hS3h6fQhS30J5CJ\aJh*_hS35CJaJh*_hS30Jh*_hS30J5 h9~hS3hS3hS36CJ]^JaJ hs~hS3h6fQhS30J5 hS30J5+hh3hS30J5B*CJ`\^JaJ`phjhS30JU hS30JjhS3UmHnHu" #$%&Y  nOgdS3 $ nOa$gdS3 $ Oa$gdS3gdS3$ nOn^na$gdS3$ nOda$gdS3  nOdgdS3n^ngdS3 7nd^ngdS3 $ Od,a$gdS3 $ SOa$gdS3  On^ngdS3  Ov^vgdS3  OgdS3gdS3$ nOda$gdS3   ? @ v w     " # % & ' * + øåwwwwwwgww`\hb& hS3hh3jhS3UmHnHtH uhS3hS3CJ\^JaJhS35CJ\aJ(jhwa5CJU\aJmHnHu$hS3hS3B*CJ\^JaJphhS30J5CJaJh*_hS30J5CJaJ h9~hS3hS3 hS30Jh!{hS30J5CJ\aJjhS3UmHnHu 3 ? @ j v Zkkd$$Ifl0\ t 6|644 lapytS3$ Op#d,$|&#$/Ifa$gdS3 Op#d,$|&#$/IfgdS3v w xZ$ Op#d,$|&#$/Ifa$gdS3 Op#d,$|&#$/IfgdS3kkd$$Ifl0f\ t 6|644 lapytS3 xZ$ Op#d,$|&#$/Ifa$gdS3 Op#d,$|&#$/IfgdS3kkd$$Ifl0f\ t 6|644 lapytS3   xZ$ Op#d,$|&#$/Ifa$gdS3 Op#d,$|&#$/IfgdS3kkd$$Ifl0f\ t 6|644 lapytS3    xZ$ Op#d,$|&#$/Ifa$gdS3 Op#d,$|&#$/IfgdS3kkd$$Ifl0f\ t 6|644 lapytS3  ! " xZ$ Op#d,$|&#$/Ifa$gdS3 Op#d,$|&#$/IfgdS3kkd$$Ifl0f\ t 6|644 lapytS3" # $ % xZ$ Op#d,$|&#$/Ifa$gdS3 Op#d,$|&#$/IfgdS3kkd$$Ifl0f\ t 6|644 lapytS3% & ' ( ) * + = > }$ da$gdS3gdS3kkd$$Ifl0f\ t 6|644 lapytS3+ < = > ? ޶ hS3hh3hz h}hS3hS3mHnHujh,sUhwajhwaUhb&h*_hS35CJ OJQJaJ hS35CJ OJQJaJ 21h:ps. A!"#$% FEi} Id  ExifMM*bj(1&r2i-'-'Adobe Photoshop CC 2015.5 (Macintosh)2016:10:25 14:41:41 &.(6HH Adobe_CMAdobed            f"?   3!1AQa"q2B#$Rb34rC%Scs5&DTdE£t6UeuF'Vfv7GWgw5!1AQaq"2B#R3$brCScs4%&5DTdEU6teuFVfv'7GWgw ?TI%)$IJYW3z_nѿwkւ~LN1WJUm  e# [3!\]8_3:] ^dž+N \+~}AwӬ<$=Z89W724?4?lOBc{4~lqT}_Mi̪Ӵx+ W}S D0~{3K^uدJ&&.<.ҏn@ </RI$TI%) '+vM>]*]`[h<4q]ܲK lɴuٴ{hooDN Kk(gs$KtT.Su(x#'>bIr!Oϓk/ ]bg>! cd\U3ig(ozk)71k{67Vs~VZ]vsO,g C4{ðfגwQ0f~K֛ԯWQ>n6`7T^=?Rk7xSߎ12'kk?Eǥbz_J,kgв[չh B2/xy?V:׳t=Isg, ulS}?{"GrafeÚ?=~;ߍw٬26ޅgQɟ_ W1n?HhL1$ LI T ܺ.˷X^-SKΐ|P&,aǒ;H8X]{k}ۓc2ms(=z653k\|v\Tkhw].6K[S,I${MJR8=NW^[K\?yc}+$ĉDF1ꭵT]lc@ pֵCGRZ[VPn,]p>c EIxFGF;X $pKp7]o.5:ߩ=8TPZei>t84ɚ.9PzEI&3Uwi=2CgYk?Ꜻ%C`?dc3[KwUvRb //1 БH_%Yݙ~] ᾨu6b{ڳCZ{ZZO3]7<^I9LH` I))uk=K>/co'UѪ ]N沺%ikOyAعlig7/n$ITI%<_־{lX.ƴdyiϥg+?I?5`W#Gw7I鮱sKnCS\n*宧?$ n11s2 ÿU]Xݫ^<5X.fƻdww'?듽Ǟ@ң:ǘX=f~ ^]ͥO.3}b~3 7ӉV;Q OoWS)Os~lj>ۙpmDd]x0n%ꖕAt~寒)%Y]+ޯ , *hM'N?]EXYӺy+x^'Ӗ{ݓw_f=? "r͖ii~uv̩6#M2uVbz|Ow{@8EuhNg$ 7έ\5ddVmwҴ!x3WwW@4I$STI%)$,7{4wO֬w;-Yl =Ou𿜱/?W]|w|]oE>SA#ļYgci,? it?p?3o zVח }ֳf?]kIP;kmNWMmhkִֵ{ZֵU!1?RruuWS*n娡W3QI$)$IOTX^Gذ9yX'k\D, ..47{"nc랚ilG(_(e?\ƼmxJO8uc6AebA w`;cJ~S*>Pici-V-XrOq_@>ddžsƵǿIn34?X47!Wy鴾&A{C齮G?6LٙL|,{ZzG?Go~^n (~.%I$cRI$I$~W]ٙ御c2.c=p!"ABl_SQq. gKgZ(վ0cbn0e*_0D͋ޘ ÀKڡ.7⵵D?zlX}Qnu7Xc .!cn]C虙 6{o~{FEme=Gv63zpuh ;}oGZ}A8I8 gܔqzɯղsu:r}5ve"2jW3-sysg]*;w35b kKr :n ,v亮 5Fx"?x޿C/q3W' tlW6eP1Gw{3~dXz zG k^f[o*:C9 53mn>zl7窎kEtJɟug>쭿bD׶' "z<~eLיּk?îwz-vAv-}DV}Kpcg'-~_D.I!^*wv:}N\1V5eheYn-sZQl~ ⳣ%藲aG!21oDLh-G&+8ᯱqt ͡ՖΟԭ~OmV8}T~g[bK/V}VE51AuUmf𕾿? xcVRb3fLTqˇ,M : nOJ2ִՔZUW ߫ZKj󅓕wMV=ChhwoUr[G1W?72s~ΟӲY[hmlpZES3u4:'oߣr&?? U7,[o+SP$Fpccn~z2+uYp6]F{6eWSKۇfMWYֻ*(L00Ȗ]ue>_^-9ջo6ѥrQŌϏ!zF.9,0ZMjJ˩nʻ:͡!X Ώ#~F ՗^=yYUnA(ŦK,etUG٫dUzEbdW܇SC1ٲ m޷efE5Xp30Zz+:5/ccŵ3_n𿾳zэ֫h%<6}FaOmN?z_Jޘç#SNWQNM5u9عt:.?UI:E{#-F}z}W;W^+}:j\Ke޷$7{ (A"Ry?W0m ֙"~~HӺE=?'/"f{_wYd3k[+nh»S*ģ-cۓmn%7:E[GFaþビ]EvYPo=jq}"dM11 w[Z?~\ޫ'nUcggi_Ι]x-EޣImY]3ܼAdafdOҪ,ڬ}JjlӪ:%etمnGf>Kr벜Zf^7MkvuvѽV~ό[c20W秧OR-fLna۴m5 \W;&|-f.엵[{?$'ۅW^?!vPhotoshop 3.08BIM2Z%Glogo college doctoral vertical8BIM%p1 ,wM8BIM: printOutputPstSboolInteenumInteClrmprintSixteenBitbool printerNameTEXTprintProofSetupObjcFormat d'preuve proofSetupBltnenum builtinProof proofCMYK8BIM;-printOutputOptionsCptnboolClbrboolRgsMboolCrnCboolCntCboolLblsboolNgtvboolEmlDboolIntrboolBckgObjcRGBCRd doub@oGrn doub@oBl doub@oBrdTUntF#RltBld UntF#RltRsltUntF#Pxl@r vectorDataboolPgPsenumPgPsPgPCLeftUntF#RltTop UntF#RltScl UntF#Prc@YcropWhenPrintingboolcropRectBottomlong cropRectLeftlong cropRectRightlong cropRectToplong8BIM,,8BIM&?8BIM 8BIM8BIM 8BIM' 8BIMH/fflff/ff2Z5-8BIMp8BIM8BIM8BIM08BIM-8BIM@@8BIM8BIMq logo college doctoral vertical nullboundsObjcRct1Top longLeftlongBtomlongRghtlong slicesVlLsObjcslicesliceIDlonggroupIDlongoriginenum ESliceOrigin autoGeneratedTypeenum ESliceTypeImg boundsObjcRct1Top longLeftlongBtomlongRghtlong urlTEXTnullTEXTMsgeTEXTaltTagTEXTcellTextIsHTMLboolcellTextTEXT horzAlignenumESliceHorzAligndefault vertAlignenumESliceVertAligndefault bgColorTypeenumESliceBGColorTypeNone topOutsetlong leftOutsetlong bottomOutsetlong rightOutsetlong8BIM( ?8BIM8BIM f4L Adobe_CMAdobed            f"?   3!1AQa"q2B#$Rb34rC%Scs5&DTdE£t6UeuF'Vfv7GWgw5!1AQaq"2B#R3$brCScs4%&5DTdEU6teuFVfv'7GWgw ?TI%)$IJYW3z_nѿwkւ~LN1WJUm  e# [3!\]8_3:] ^dž+N \+~}AwӬ<$=Z89W724?4?lOBc{4~lqT}_Mi̪Ӵx+ W}S D0~{3K^uدJ&&.<.ҏn@ </RI$TI%) '+vM>]*]`[h<4q]ܲK lɴuٴ{hooDN Kk(gs$KtT.Su(x#'>bIr!Oϓk/ ]bg>! cd\U3ig(ozk)71k{67Vs~VZ]vsO,g C4{ðfגwQ0f~K֛ԯWQ>n6`7T^=?Rk7xSߎ12'kk?Eǥbz_J,kgв[չh B2/xy?V:׳t=Isg, ulS}?{"GrafeÚ?=~;ߍw٬26ޅgQɟ_ W1n?HhL1$ LI T ܺ.˷X^-SKΐ|P&,aǒ;H8X]{k}ۓc2ms(=z653k\|v\Tkhw].6K[S,I${MJR8=NW^[K\?yc}+$ĉDF1ꭵT]lc@ pֵCGRZ[VPn,]p>c EIxFGF;X $pKp7]o.5:ߩ=8TPZei>t84ɚ.9PzEI&3Uwi=2CgYk?Ꜻ%C`?dc3[KwUvRb //1 БH_%Yݙ~] ᾨu6b{ڳCZ{ZZO3]7<^I9LH` I))uk=K>/co'UѪ ]N沺%ikOyAعlig7/n$ITI%<_־{lX.ƴdyiϥg+?I?5`W#Gw7I鮱sKnCS\n*宧?$ n11s2 ÿU]Xݫ^<5X.fƻdww'?듽Ǟ@ң:ǘX=f~ ^]ͥO.3}b~3 7ӉV;Q OoWS)Os~lj>ۙpmDd]x0n%ꖕAt~寒)%Y]+ޯ , *hM'N?]EXYӺy+x^'Ӗ{ݓw_f=? "r͖ii~uv̩6#M2uVbz|Ow{@8EuhNg$ 7έ\5ddVmwҴ!x3WwW@4I$STI%)$,7{4wO֬w;-Yl =Ou𿜱/?W]|w|]oE>SA#ļYgci,? it?p?3o zVח }ֳf?]kIP;kmNWMmhkִֵ{ZֵU!1?RruuWS*n娡W3QI$)$IOTX^Gذ9yX'k\D, ..47{"nc랚ilG(_(e?\ƼmxJO8uc6AebA w`;cJ~S*>Pici-V-XrOq_@>ddžsƵǿIn34?X47!Wy鴾&A{C齮G?6LٙL|,{ZzG?Go~^n (~.%I$cRI$I$~W]ٙ御c2.c=p!"ABl_SQq. gKgZ(վ0cbn0e*_0D͋ޘ ÀKڡ.7⵵D?zlX}Qnu7Xc .!cn]C虙 6{o~{FEme=Gv63zpuh ;}oGZ}A8I8 gܔqzɯղsu:r}5ve"2jW3-sysg]*;w35b kKr :n ,v亮 5Fx"?x޿C/q3W' tlW6eP1Gw{3~dXz zG k^f[o*:C9 53mn>zl7窎kEtJɟug>쭿bD׶' "z<~eLיּk?îwz-vAv-}DV}Kpcg'-~_D.I!^*wv:}N\1V5eheYn-sZQl~ ⳣ%藲aG!21oDLh-G&+8ᯱqt ͡ՖΟԭ~OmV8}T~g[bK/V}VE51AuUmf𕾿? xcVRb3fLTqˇ,M : nOJ2ִՔZUW ߫ZKj󅓕wMV=ChhwoUr[G1W?72s~ΟӲY[hmlpZES3u4:'oߣr&?? U7,[o+SP$Fpccn~z2+uYp6]F{6eWSKۇfMWYֻ*(L00Ȗ]ue>_^-9ջo6ѥrQŌϏ!zF.9,0ZMjJ˩nʻ:͡!X Ώ#~F ՗^=yYUnA(ŦK,etUG٫dUzEbdW܇SC1ٲ m޷efE5Xp30Zz+:5/ccŵ3_n𿾳zэ֫h%<6}FaOmN?z_Jޘç#SNWQNM5u9عt:.?UI:E{#-F}z}W;W^+}:j\Ke޷$7{ (A"Ry?W0m ֙"~~HӺE=?'/"f{_wYd3k[+nh»S*ģ-cۓmn%7:E[GFaþビ]EvYPo=jq}"dM11 w[Z?~\ޫ'nUcggi_Ι]x-EޣImY]3ܼAdafdOҪ,ڬ}JjlӪ:%etمnGf>Kr벜Zf^7MkvuvѽV~ό[c20W秧OR-fLna۴m5 \W;&|-f.엵[{?$'ۅW^?8BIM!aAdobe PhotoshopAdobe Photoshop CC 2015.58BIM>http://ns.adobe.com/xap/1.0/ logo college doctoral vertical Cyan Magenta Yellow Black DICC_PROFILE4applmntrRGB XYZ  3acspAPPLAPPL-appldescPbdscmcprt#wtptrXYZgXYZbXYZ0rTRCD aargP vcgtp0ndin>chad,mmod (bTRCD gTRCD aabgP aaggP descDisplaymluc" hrHRkoKR nbNOidhuHUcsCZdaDKukUA2arNitITbroROvnlNLheILesESvfiFIzhTW viVNskSKzhCN ruRU$frFRms.caES@thTH XesXLvdeDEdenUStptBRplPLelGR"svSEtrTRjaJPptPTLCD u boji LCDFarge-LCDLCD WarnaSznes LCDBarevn LCDLCD-farveskrm>;L>@>289 LCD LCD EDHF)LCD coloriLCD colorKleuren-LCD LCD Vri-LCD_ir LCDLCD MuFarebn LCD&25B=>9 -48A?;59LCD couleurWarna LCDLCD en colorLCD *5Farb-LCDColor LCDLCD ColoridoKolor LCD  LCDFrg-LCDRenkli LCD000 LCDLCD a CorestextCopyright Apple Inc., 2016XYZ XYZ q9gXYZ a#XYZ # curv #(-26;@EJOTY^chmrw| %+28>ELRY`gnu| &/8AKT]gqz !-8COZfr~ -;HUcq~ +:IXgw'7HYj{+=Oat 2FZn  % : O d y  ' = T j " 9 Q i  * C \ u & @ Z t .Id %A^z &Ca~1Om&Ed#Cc'Ij4Vx&IlAe@e Ek*Qw;c*R{Gp@j>i  A l !!H!u!!!"'"U"""# #8#f###$$M$|$$% %8%h%%%&'&W&&&''I'z''( (?(q(())8)k))**5*h**++6+i++,,9,n,,- -A-v--..L.../$/Z///050l0011J1112*2c223 3F3334+4e4455M555676r667$7`7788P8899B999:6:t::;-;k;;<' >`>>?!?a??@#@d@@A)AjAAB0BrBBC:C}CDDGDDEEUEEF"FgFFG5G{GHHKHHIIcIIJ7J}JK KSKKL*LrLMMJMMN%NnNOOIOOP'PqPQQPQQR1R|RSS_SSTBTTU(UuUVV\VVWDWWX/X}XYYiYZZVZZ[E[[\5\\]']x]^^l^__a_``W``aOaabIbbcCccd@dde=eef=ffg=ggh?hhiCiijHjjkOkklWlmm`mnnknooxop+ppq:qqrKrss]sttptu(uuv>vvwVwxxnxy*yyzFz{{c{|!||}A}~~b~#G k͂0WGrׇ;iΉ3dʋ0cʍ1fΏ6n֑?zM _ɖ4 uL$h՛BdҞ@iءG&vVǥ8nRĩ7u\ЭD-u`ֲK³8%yhYѹJº;.! zpg_XQKFAǿ=ȼ:ɹ8ʷ6˶5̵5͵6ζ7ϸ9к<Ѿ?DINU\dlvۀ܊ݖޢ)߯6DScs 2F[p(@Xr4Pm8Ww)Kmparaff Y vcgtndin6@UL% PT@333333sf32 rrqmmod)!!Adobed@ <     0@P578 `13469!2"# ! 1"A0@PQa2#wB3$v7x`qR5u8brC4%ՑsD&6סcUST' !1AQa q"20@BRbr#sP34u`C$t6Sc5%&7DT #~|<<.=˯g.F!ɝ9OGE ߇9sm>h}?xN3..>ǟQt> r᝻su/=ˈ:xׯ~ 󙯺c>-~r|1+Qzjx_4vlMl)'~JbZxwe )i6 6ٛ,l,Y'rS5e<_z*_pl}&TQr_~{'%gT~ٞE"D"YǸSpzAQ~LT#?Q.n6EY '#q cM]m9@rusk Wu a,U*35W1if3&E0UNSWu5vmMwu<_9ff=]wZ.jwK ęu\ 1'W~R8o]uUA|d,eu4wmKWTCpk}QLo>E4m%"Y'{=2㮾2gNUy)8N*(/sf=5PeLreDzmO~,_zﺑK_j@\v}Q2cJ,uϯtb^ސ{_>}d qW8tőuNru Xv~g\ fZz;>㬶r?~ uקTz[AuحZkMWjܦĶ9c s1T}0&h'fų0WdΝ߫~v[?oik-S_쭥|_e0:l7Y (tU}5psߠM\Kr7L uؔok.#m\##󕆱.N85žV@ =3 ߣuOEp_w@YR 0}!U _1aέ쬵=ob1я'I )U󆿠ҹ ][t B2VShNzKQw:kp[=e#h 0lour}H׎ j+AwWYh{2t|SU} gꆢE]sKlf,xM t^,vn]0}Ʋxg}޻ݓ»_=?#ʵJ3 ]%s k }$k-k3&϶l7>}÷C讟n],vq;_t_9^Tyz[vĻIrƲz;0$Zm O-ySC>y˥u]6RZ$w!KC0v] 4,=9)̘f1W-}[7R4NX]=M}2_hr8 K\ e췆tEuBD+<. Q)=iY"y,mcj xҾ`Gw!؀χuV[>5,tfX4zM5<U]LC"-Gsƽ}ih3Tz{:?;%Q@/UoDL4S>W3Ww*`ċ b}ٛktj-xֶ184s}k-!:Ojb;2G"Zɡ#i,yZ`rz ]iܸ7 SbO]pzV\{z+7 SW G_dj-T?$}\^}LkEAGr}}lhvخztlWA.xLay#I]*|9 ś:pƼU5pWn}%W-'is=}qhi9ַW4y7n5-׀5/fQ]G+W?@h4Sww!>e7R铏XŵGl_y֏]u=G%߈Hm @w"[v2+NtL:w>,|z_>яrnUn7Z|b#}f,O7ߛ8<E6~.<  /XJ ZYX1N63OX63ih@C:"7.W*_&KZInqz\|bTgL- ]5:sKpsulZqϤ <=+dFMh)4V~l4FQ*Oy P>ۡWAm_hF/u93I!NdQ Y@aR#Gìqt7a}$up\1ף9ٰV`4UĀ#ϔ^I]k}0rc웷4b['& k90o"U֞ˀ>iͫ+6 vZ}.}!yE.";V`b^X0 JWo+/zn %>ru7 `+Ar$ۮΥ_z}1#ֆո\&Um,LYs\rwlC6B mS`ԫ4ns+t>)_NZm]],"|c寷D"ɭ)ðZjk{y`>C1Ϭ cPŝ#x̳ cM5JI *Km]abY;nw1!5֞ˀ|~Ąch.f] Y|Y:w sُ!-U]Znʴ21?#_+ n].y u|2>,/7ʾϽcF {;_^<{=_cZ?d,߰\1ףj,ĨI5zo*yFW}0Jz؏+tn>Dz=nE+ `dZVb_]mcվi.dz/ Ιf;sE?#ud^έgku#E2k9~cŕK fFR^4[F?٪GgeI`T1܃lyru+v; 뿩?eCB(hnTs^C]w,Y+!S~U%j3]Óe*5'^ϱAxG +IKuS?8)9hJkc APӘZh%R rށQߤt!ymvF&w*G\P#uٸ㼟::6}PcagL+,A0j5vtUU? cK_({/e5bےv區^xO]{(tkK?[wlS]{Pݺcw*_C:%ǯ lk2/ߧ!'z62BE;e5V]1]} TmP5 ޶E.÷A讃F Z=M(4G@RFbXW`ګ5^Eon\tJ%Y@ V^;i85Şiu-ɶϬI?~Nq\\mb_w# aN7yxXL1\_yȾqgPĴzDf;mC]˻b`,1MT8s9}#`Y}(42v٪ )cE_;usf{z@z;" /n1]c2d<+9;\ YFVK1w_~܇Hu}V;z!|6k#G@wEwc Vڍk C%,o;:mWF$rdnǐQ_p]ԻsU@^9u]*(Mv]q_}VSHtchpU9pv^gZ6Du2ϣ#o=p#ҊK ]i Y䊯cIRےZo= mfʸGv^v\1= RKߐ5 ה^͙-4.\D@;m8(1y@1E.&p7K|E#(=q+8KŎNMb 5z[i_|z;uJٓ4ו5zݑJEux=.oȝ,Uc b@0wE7%Pv.<#uTiM% :0_,Do@OMU{8tP@:oq>Ӽun\k|UnGڪ0/?LWpZ!GtyˆV@ie z/# 7Lzq9hϣߛYl_t:.p k${W[ 9tڒ9)~Mq9hˠpCtj{)*W>QW5^S>ðz糯wtkE6Qh5mVu\@m5]#kXy8_8v鷕Tۺycr;ɫެ1cLJ;S .@s@ƚSHzh륂vU_w~ðL.GCmUw~}=eTk}>zOYfi :]}k=fS>n5]1ӀǞ޾9߼wNݐ~LUgϠdnέͪv\:O]}~͎ڊ?+:f½5?ˆU[OgH:s5`غ=p/EV;i*h_.:έǞK}q9b;Q7]5QESWkE_:GgNA޹WgCۏzq_wD3Wu6ww}@zݺ`9?;_.ˇ;ˏ/#>o?\}c>ßϫ8Sfn_z>=n'\;2/gN[=X ,kûut.'gp>ӑy~ry=ij|L#XoHC^hI]EBqzdVi|̝P_^6l%tgowW {_u1{C_9dB4SzE`JBO$:*K;&n${K76Qc'IOK,!8ѐx~s;j&;8fNm'c~Oh 5`)"@Z%y'u 7 [k=?׺]YJ67=u`n%:S4˵Q`=?aϕ흖X4V/Wy!QP_^3p&_#(RCOj|洜HuxWf kd1@p*7}kAjOߺoHC^hI]EBqzdVi|xܣ~b9zlɝCur$֝aP 8exrnrS\u`%V̥v ʹO\_hŞq6UwQYҲXnמ @Xfs2i%٪"MY^x i J7dҧ$ְ/Wy!QP_^3p&_#ôcG ɛ 0k՞Y"Aws ca8rp~#uس`1ߢRE` NLo fc7+I5FӢl}xU/FSȩK=vƔꢶH5ZՕ"dn|܄0]p OTJl7@3t`,[;Ři@,¤`9%0 ޑx -mГRɛ5vKr|q6/Wy!QP_^3p&_#+}ضt3xP {crGhuhxP/Fxkx ㍎Fae^/*#cʹPh3SryoHC^hI]EBqzdVi|n9~'[45,,O {c}V3KR|e~#B -Ơ2Uކ22PAܴ*˚~y:IY^Yw ybcZ<@x=V/Wy!QP_^3p&_#+ߘGn۫-@eApnX%OցȞsH^W`_5XV^'ar$֠6)-}ô'k5O?0-֪ҝ9e{AdO9M`Uz;Qۺtvn:]šا[d!/Wy!QP_^3p&_#"5f>G=2ǒ[;q`}>~9z'c[69>TZm 0=Қ[M$Y`*(Hȍλb[eO)}Ͻ@}>\G6>ҟwS0y `̗Q>v"kf!!=3=mJ\X\/Wy!QP_^3p&_#Y6Fm}fjU'|٣j@=h/FUE[&;'eV#L읖e#sl  1MT}]IY!וc Cufpn+&yj#`)"@Z%y'u 7 [k=?Smq[|Izy H\BlGos{.m*{sX҈հl9tv{~uJY`Z)Cw:)#[/z/p{)J \1X^jm'3l"lڃ5DyS0MҘX֐-|㒋 cOMN͙Ģȵ N\Fm;;mΜLMы6ei0zyN LN"7 ݡb^78ymTWs{X o_r`Oo>3UruDthA>gVo7]dl}}r.hs<3-\Lgu wm !$'aÒHTJcbmQ1NEc?5YjG[t&8]7\}_6956#߱>6 SP.al@X^@$>t&m _f]I*o 0Xhh̰Y`-}-(d5Y\~0~}NYo|]@Jcs#y!O$ju~rq}SkL0/Q^sU;EpMWͮd"o~| d*|َ8a@~ o=)PJϚ}"?xt/mh̰Y`-}-(d252e0'=+vr>ϿϿp? VkP kUhxukas_ml.:0J:^쳤cn:dlWX3k;8q6Œp) T4U+g`Jw-KM\oA)smD9˸5$N1>Yg[%l{UO϶^oW4<;GEWƩsRup֙bHQĵcȺs}x^X纫Ev.>\E]k k`wQE4\+%<3fz %%2n\/_}C@=n]uX>sGL g ]`HDRNuV[zcqܨFL;=;HΞoDŽ {c].ZcW_>kz)%p Z9o&]@nds*zx ZB2]ZNa̺ i'=Z(s^7tqHX#ncM 0⚄g1/UydSYjh\ # gO7]pLN=1CN g)ihYCo _7c[qM9nX/M f<10O8Qzb9/nms!s}u.km%G_=FmyK+Bv1Ov,Pl&HH~U>N:׮MwVt;4X;c]U#:y,{bqшAz_|L{iL# lzi"BXo}Uz; 9T=)PSs1/øxfmu eg?"'=Z(s^7tqv1r|*?/e8Zf]{iF4ۡ%5vKH&ػ?wW\IOuX{ BvTxKpǻF8}ؿ)E71l=@֫9dcQܫoW-,}P8u@w!0?~ [WaE Fmm7d]7RF5ak}?ˣ"b%o vUQ'e-WbSLE xl&}]B8>Aq{uҼMW}/ +X/to_c;dݺ:&9I:qmһW[nO~qu۸ޚ: X>|Zm詇륟ț PT 7[6RVŝǹ6ZfJ_Ri:'1luض ^ZYWExstRcS,S]{WH)on[{α50o9_=>n`|Bo_9:UsuM}מFDKJ:H#5վ~,>mqd-uSW c^z8S&APyRhWP^ !7^dlYdß[!c/;; ;y%=V# w~f}>N*zIQp5+1.Ý"О#ȥ ȃym٫km-]UKapow}??kUA:shZZ9(}I1QNս߾Wy9 jkJam l#ghq]p]࣭}]/s=&| o.APLyfRxlWm'xꯎ2nW~heP5羟ё1WK/%ϙڪ7)]}D>8&S,O.<М/&0^ύvH_C>B]}79|co]~}Y7mj^ O-:FK:QMp=M}66n%nUVE?bR6ږ?mtn_U-^Νs*J۴f>?ު*f0uFi㬥6GI>Wy}9|h22Ey_=r[Y-wDgX7]}Ih.Ts:_>CGe9:L g&s~*=.7{Q䟝Nޟ? Vc (}:qMՆ2Xc&I˝]ߒm_r< ;O܅! d "fYfewʪI]~0<3WOOLI8vcί$*Kg8m:ǟJHĽ?>i骴1]c=3O9Ǘr)E-E׃;/uw什6u[sx(rWtK6uI1}Q1R,!Ykh骰'}?Ю.9:L g&s~*}U#}hw>3r=Wh2wr?>}>Qb.ޝxjjHCOUU\ŷʊIM\?Y-^g!_nj _Jx(뺗.KY#*l]2m.WVSmLQK}4z[A:{EF琉ri+wǸ[0wD[n3sw+NtHǢs˝eid&ᨵT.E=SKU𵺭{AA+)RcRu%OMߡVLS kPR=Q HH:DiV1A/Ch6^P3hTd,;?(>w~!UOuQ"&2Vln'AN҂Mѱ֓t|@Da̝[ܕ6̮!#DgfK/ M[HvB!lpXTؙ% I8nзY4=j(;P{ JID11|[ ,ef3܄1 ,b(iZ}ouSZ\ڿcCb;t`d0 ."u3ABō_?c X3hYmAv,^H̑Fټխ VaB$Jh6ɼv^崍l U>_(=8Ζ6*hEOn )&RcTiVlm"H=7bpA!_H2HޕLgdjZlOȃ@Ob`l@{kB($A{k@N>+PޢI5AވKOX6|]bhJxy4T[A@ZUA'DAF!]&BK8W2c՜Ka}$bQ-/XD b0]!/,E8Lo`zBI-4VZVݥ/Mt\*Sյ9ؙCcxQ,Go@8r)ũSi UBT.T=B=Q宺h'Fү-t-ђh}4tZͪ6zA)j*Q wvq?v/,[|iE[\`Ђ !mX6Da&%~>JVhx\#wĨ-|TYe057vt=@bA⧂W2غ0 vFH eH:Ҥ=a;PV{F/N Ҙ˙99ۀ0ITi4D4V}Uh N^nOhpyxPVlMz2 m48t84&WPMNa׫!j΂c"΂q뢢HXIeH{"hYO!rwi bFa$Su*HZ# Vv,]~0IX3I'H%'Bh!Tu!4 Bjt4)NKS u ZցQjR@S€(5ZV@Rc V1hc+ZG]/ɧcx0 hqSBa[MUš;N3Td_]]ttam BSBhhL8}@cE>l+̡C0!ZPV{aQrx\ DJSiJ∝@tsta.3( TUw,'ERVyp QMB]tuWTynpݪSU|AM %4)t7UюhfotkRˠ~͈T eGUt> SUE]]Gّhf} '_wّ !ЎzB, 2#WtuJR-ZҚ`-*44+JN 4#]VPJ_V 5CC]PApMTSU>])Z$ aU+Zjן5>yk^~מ`ֵBXŠMP4J]TCE5@?aU$HP骄T:j)Ok ̃^`:טu+1]yk^d`JSpQkj_; Dak\ܣh㟡zFZ>\:muS+rJO&l?EQ t׽NLN^gw=t׽Nc|Z෩Ÿ$F?OIM\ලd(=0J*NE흢tl%:#?MˌoVQWD .QZֵdb&>NE흢Js Jv~HZҔ~{"du:WC%R&'/rsnem"_jv&&Nh  E;KVذ͢dIQq"z8mĒjYJm/97xDz{gh<&P8#[x:/QڑDVsC9-u DTCӨP;ZI,JeHPB\c[HWڝ5)E6>Vʍzw.媁TOkخy@ߥ2c])RdU1(^%9j剋wSt'Qh/.RGb]J#5薫A]dDu:;l-{%VWWٻ=;E}бjt:>*q[\RTBzkZAUk^5M>:'sA;EkT3 (mZ_y}diQe˱mq >G*ٻ=;E}DN{ũ<$HjhI`@-T&8' ^thTEh8x* ,[Bhg?fV/l7*W)QU,a!5<>#[T,2ZT50RO­~J֨c иxh8h(XZ%LIl!$&!DMT}M608D<4򻄱mB@:r(PW c[HWڛ;+M!(@O+` EIWp݉KF2Lꖬ)$[St!_\hʤriPhF!f$T\,EBA<97xDz{gh6+bIq!kZ{V/&2E6^mO]muKPO48ڣZ{V+^II6z^W]d7hTzPƍٻ=;E}~7 :^HkZֻDKuIz Qmu&O]6(ђjE%M֕ v ƛ@*x|}97xDz{gh6Rsb?xhZ:O$}%NGi։N87?pQW]MM Y,SBUHA?fV/lJvfc\}BѯPk- FBѯPk- FBѯPi+j$CyU!net!wT]֔pXW[:P#ݱHjKkeiK@kJҽ6*p|ۻ>=sG={"p-2j4tN(Wj4;& ,GQbIIPvatCA+F "` KKrO}0ӛ\_jlY(g2۶FֽX\MccHēiCv?~D]ҍ/;ʡZ3I46ay$I{kk+ET8*Ȃ>ې/ѱ +J C5IA7P2Ά!QUSkD坙);Nmq}FCeF$tN:}HT!ARg>8mn%T.ZBcH !t/w~ i njzK0LKt[2F&E,`#BKU{Nmq}Y)R2Y"Kk)ܝ3=N.+k7{׽{׽ Y G2FX қM(,ztair7 A6[ fo4yf:5QՉm RHv1 T} 4>!c?z#8"qpf92 tζ)L*^\ɨoDٵ'{չȞ0O*^萁',$/9C{׽ZވuRzy ZvP:<y@݋gjkrq";AB RCP)ѩW'/LЊ4#jVB1'H]NnXH5Ahp{dӇ׳85i^2Ɓe${o^e%Μ?=6 j~% 'fJ5BbZq&RV#*&@I L Q$AZ:Td?(c{= chJVASD èM^٫3Ґъ0dqKJ="e:%*d,XҕҀZC/ie|eŽɥL[$'U\ES#^<t#Ѐ WAxU!_cc~߫'tZt}a337Ce!UL)EZ@LGCIc %?Yki!jEZVhzv`[dj?&`!"jR _a怱պ h*e(Љ%`i&J0bM7UiW&ܣ^0iZW nM/E.RzhtYNIRO3kqDK-ux 1R he`i_BHzq#I I֤UN# "Mmr4m~HITKR8ڕ*J҂m\jTá'<+ZU+HA7V*+}{mvdd&y5nBJj%[ё#ѱ飚HiPץ*HDA`w#d$oD]Ueɷ 'e+JaLEG,+Ђ W"H2cg ,FV*oUfi}7 '|>ĨHPU*@L@q"m!VNߡ9.ŘYflpBcҏr4_Q4G?[mZҶ.ֻ;PW/ krr+Wr4x._Gc,J1&Is{+U{C%@dž^=EY!4JZ.uΛBM礘_H7aԱx=J#u4cx5YtP;" ;_pjGV9E)T?^֙xW7)@=܏o1*TZ[lu>]n^@"C֞*,<~7ܙU"xd4}:?E#R%uܘe+JҽfYsb~kOBj/'g&+Eжf7(㵵 9&R6RWM x u:`dOqm "Hg!\JvDY3x[A8۹+3tdZR0,~**Lii  >pl&rLWՠ0=9oF;cejV&yl8 r{k Rއ( $ XI%"]SBO!@{A# Vi؞#n]NE,Hn^cyYmVݩZҶmؓQĿhN!WFo6dRKR,#HXu?6yl dU;EJD؆Lc b=WN1k+ֵksmۈܤKqI|›p09;5TMV/] c:O=ؗlTiZlAwr! Xސ/\ֲdWzҴ:^m7b9[/K /L0_J<֕təsVGA,%2QDa]+ZֵW!ÄbGFmEɺK"AeJyA;d)3,biA!n2B! Ctm`7YiGn;kؑy&l:yA#I}#g ?6n?і.c . U'#RS6guĈFzrmT<*`if"ސkHqkM_[*m㴉+ZFZ)τyhfDm[~+6WO-I^d%NT=Ҩk3e41M30$5 _ 2ܶq{YV] ݎ重 nz~um;EG(Nѵll_3aSBϝj7ATkcqJHU4!oZx-SYuli!xa`|{ ioCmoTz\ v8i.rtM|ݮA*h`WNhB1j|2JQfZҭ^?Y3Duد^~/sY{~xe{1׵S_ߋQ>t^Bh}˽kW-ftНs6 vbcQE蟥'\E/٬>K~I;Z*l_ow*2d/@BZXW消RֵvdE Rev|n$Dca+H |mD`Qٴy#iJ;/[2}`yCbxGk$꺖R5sS-޺w6I7u ?niQH:d>l"Q ^Đy}_!q* ~.f-3Bu iL`ȵǡ}O qx.cK Na4{GuH/3j֔Q؛l(SO;T&J Bs9Ԟ?eu${y^n{JLJ.QjRv$5}moVUM*Cu&W:+Q@hBK*OX .%΋Vs-ۤc`vsv(1 h)ǵkJP ])Er7V+r'TFN\ux1F$w)*udh[r6"l?I1 QՇqnֵՆiJ]eJ!!xvm镯iJ֥̓eFxFGU).eIӋ~BK'`civiJBB1Tb5sKp}Ȩ<֔+N(EhVQgQAn.~EҔ6Tg ^ہ/) orovKݦ5cVuZ NGvvjZRcJV$62cEU)e#;l!a۬\@Z椹|t]3bJ=&nkJP*`A5]65eIlmUgPjTleRC5"r% ܨt,.(]])!)n/)`Ÿ 9]ԛ(BDQz=A"5 Lnj!{2hlyl?؁d9ZVRt71D'%1}QXvXF:_aKRQWJ(T.{*d}CQԢPvhmL 4JҴFaet|POQ T4Qj:U կG+Y13܋(D>%bBTNزeK,%s.:=kRIkp?DƔD07( mh )12`hQX:RtkƖ@ EчE$RoZS>̀20#khpK#+dFf$}5OUk_(fhIp2LZҔ1VZe J:2,!'4:+NZ S+,:(tч $iAhIULm5P =…-Q)RA iJ P3> 5H*R^]z ע ^]z%5DMPRFq` :|U h'.ZҚ+i: )+LuU%SBW(4Z/m5EFTV=z^.ïK.Ǫ6Uk9J¬%ˏZ~Zֈgto$ ďm8ⶮLLjrTCpQQ:!REWA.̊5+l5Q( ^K5h8a⍰򱰻w ȡIl>K|mlV `-$4)NUID\QW :exbǫApNK9ϳґ e-' Wv>[SQW ; Cv]m{ DYOlhy,; cQ(P!.׶ԲܝEZd$T*ǙSܭčglaطɤm{6҉Y R%;q)YP4Y2SFH\8ܒvyyk5{rw+g#|9|+xN[32vV*\iUBdh̑Hbmz\>(9 xkZaSf-Zt |W?}]ä! -&@ŠD ?Z'H1*3[qA`v^{pĈ &ZpӻiVܛYQ7_~f7%Bϋ)HݬP\jn@ L z1&owH ) ]+nֆKsBܡDcs6ۻPt[?}]â O}[z=Ee瞒I9AoѢ$P:n\kdvwZrB0vާȮ3 b-,Vib%4;E-OYZ;e{p08_`gyF@afe$P=j7*Jrkn-čgla7[0Cq)ɸTrU⦰ݛ2eR'8VL[|;B1N2~ 9- Re$~XŝM@ >ic#ZHqrs]'sWH-F0mkMJ ۂM:37pĈQg o:,vnm:%a@[ͭčglaopiJdPӍ}C&pI7`Z-;6wohx=[*ܙ7Be*\W"9CC,(Vنj9Wuk^LѲ.Hc歟čgla]Zsyy÷-ܵ;r_÷-KqKo,>(>-5:)o.hr~+S޷7*?;r_÷-ܵ;rV-c)I? sl`ի (նaU]X6HWkVFG_lr3W|0Л}0Iɪ@f:hTy(v䗬dQl֑Y_v02n|  }^-[?}]lPEl{\z2Vzez䝶(K0&-9Vŝ@qqSo/p]6c;C_0;g#|9|+ma65[%k?{_{_{_{_{_{_{_{_{_{R8VU5ՈCj߹ JM$kkkkkkkkkkik"Z8{0 3o Yo8T~q[ⴤ/i|w xIzZ_L=t%`7?cر& 5RT~KziJׯ@y+HzKhDp1f\sd{^{[<⯋ ԭ+MMK1r %)` G̒E6FhvS'XYaXۂ{; qr3EZV6'GZK&lwgčglaKGH\m[xc6vkno[XݵM;+1(GM!"oӼK;8j;;t!#pX'OwXx9bA_B!bke5EXκ0Q%u b%:tOz/NzwBy+eVJ[[?}]|xAvB ٛ] 3hte-[ Y%.y uG14d͡+=!V|#ker:K,H][L$3wT#Qe2 ^HݲC)7?cEOw Ndv CRBrsHw,"ҽzv 3=$:Ylfi-(>z.]×@r4LnP $}xR̖NArywy;=yo8Tr1P*O~Jr#6^Jiq~s.~J49E$i/i$[k;^C;DJv7,7)sJ\%.~ɋ]ReLܽ6qU!А sM[%}&:cdutv2v vnz6=߰Q5#dR<_Ou~U@+ \H4L3\mN DG3sV=߲w_O"Dw7k7鑣%>3 s{}O|70?6FAs nD|rcNjdY[lTulo?Ks{>.ѽ6t;62#d=nYE=T*]խPdJ(TvY 2nxc%.z#.D۔Ž$Mxl2d{& \;WJ`w3f+lj+G7ZҔߋ{VHtLǕ8}݁q[kW#w9KGOYwAIܠ%=9F  5Y%t 6Hʂ8uLJΊup)W\;Dtۯd}o\8ĜN'xWEӼvtM8pixtb]k21;+Nrvx&zޣk^CJ|0[J0{:iZҶ!$qAH {E'g>'eKʹ]Mɢ:E(h 1 @Ub`dWmSvj!y;buՑnآ1V7C'td[-X-RJ͛}nm ^0L$mF?ZF$7Slau-m韻݁uhƖȯb׶5:szko7GlY@" ;boz21]]Eس#/ne2BmwM}O|7|OP:B/;_&RDŽY>OHL:rv|IhJgel|aW5$Zӑ_Odm/*QlN"gjq-ֲ؛bnYp9ђY;|>'n㳟Ur.iNMR ֚z1܎G"G8֕v2TҮO֔пQT׭t[/B*\ҟKe~eJ llD5Ml &9[lT-M>+Jm8Eq*'Gqn+zA9vh^8p*Ҵb<NIv5O u;ulo[{pq qvnFGcIcF~.E>핽qFM e0kxvdRdQ`ߦ?F9N.WmSvR~iFnȗ-mPF9^;9A"D]ۘ_lMNA"ϻKcJ{QowH kZ6;|>'6ɦF iKwk4}l c1QJ 6 k݅2;)e2_Oŕ-ju54Y*V_lMKKsmٳwTZ !om:'~\~\~\~\d"].j4b !dm8}iJQy9k/q0 Jֱa>҉\æcǏѤ(ӌYˏ%#YF6NdWrr"_{j7v7~ Ȇ1E H>%o?_?X D*Jri1#X9Ddz,nA#> .jqj~\~\~\!EWw\A B>Ҋ< !Pz* H܏NBAa CP sY4EY aZҔ*xR䨴{U}-&q&wejTTNQ6]ii}MHe+Jӹ`c2d7f'~_49AAͭR0J=Ž%8- iIrc0@JP1Ԫ'kh7kd ) wm~$a#aT*$~&*pn9E!µ(klTFa&G4OHD BzC/pjPV~r-WʀҌ$iA\-*Ch_U闬 jR0TjP4< $ߛF&ye3LM}rPI iUBJ28)_}#8bXW(dZAȨ4sc]\ts" GD)ь~$}w.= j24 0 1K yfٔ.I@Inm~í:#?=)t5M)JRHU oP!2.ĆEGi#p2J=|)("ѿH dUoFTE# %P/1P${K,ԛifL :2@|֜:JeMJ= hdC@0hM hdUAdь~$}eJCd2]I e@PI)>SaiQB`.Qj?=#{o֕ Z V՟jpNnu8(>Anԇ2fE(Z)'Τ+J-bMHV}H7 Q+)jOkdh DTF+(7N p+ݒ45&s \yw?Oԧ*@F I.c' `, 1a璘mh\F=A)KV҉}11,1ē߽ՕS֕ZցbMH"1{ϳ6yaj4c87U%хP?=#{o415JL (t4R0TUY[FZ긿9{sN<`JeQ3 0 adrq@R=a9Ǡ5:its” NK'Mzj@@r.H$6F-HeK4FzB ,\*3Ĕ8TĈieUqZ&j Ic'6i{1?~YFHr^pNrP;ϳ6ya-Kvh4amS6!IS[a L%H؀ R6(f@+ލƔ m<8z! cm0E6P %WJkTHWs6҄r4(Kz4l{;z5( mT, $@:ODHB0&񈄩JTkTRs, D@4ae%(6U3Z %S-Әq%]]5 UP6Ҥ!8tiE_[4.Mԯsub59Vjj$HR">S߶tZh$>3Mxjt" _X:7O`~˽gozxi]瞶!RLB &%x0h(GiB}12slv>-NYzJ(ncOQi)&hfRhy N%#äF.k](G]))D|^HZEYFe߫i(B`i8; (q+"dbm*|v Y~#rEw!D9F$+ sԦLjOi} F|2G_b/neC}[>ahV|`p!SlrK,Ģ?A+]l3H_`wV;#-}iQ%ҨKw&mȬ)tt-ipf6M^Xߚdh>-o@S=Y0$ya1N:05+mZ<6%sܨV[;̱H#>EE w9hWQܜě#5vp/*l>Dmmdn۶9Cc)ՓqgiPbN99󖲿9&7r[NApNCrv71pФ{!ǢKg˔fH&gyVL-}4ήcJ2`sxйp9?"CCkv6t33[/ja.Cc10o^0;wٌK.,o[wBpktozA3װIdq{͏"V"0Z16G*QG|\XˬĻ.ZfVIK6ʒ\Z sfymmvqỌp;q̥ٞ,Dkb_Ş:1?;2 $%.7Ђ ;A*I̾+Z%|czlxF7֦ԭ*jI5 ،Liʖ\k y9 _&0AΜoV}v*ٯUX6أM >*qw{3r=_bu[Yyڻr|~y-7{6$`SW'R x0ɘ6ҍFmJ5w KbR_Zu 'M5aƑrͅm*ǚX!ryv>d#=)lQ}/ kk[3~ŘaFqş mQGtMW1Cehf,^}E.o'8wm+p9.řrK#gPB0!)A`̨m-7IaV]55> sËlg6L#:e|^>xW1>Cn74pe-ܙͤ7핾B//mB8x-bm/)Xhy9 7*^n մ2w!Ⱦ,_aR:-]_'|MqԽ4ovݬ!{%6knaj81 2U6̜=Ț(NzCH+2iLjɑ\xpW_̊[,w: dtOʯ'ء / g][;0L `8sv bفb2A M!R0 fYq_LY180+~C^N.!9pMüüXIy -&i-'c9Yk $QI5BrpB[Z)/߬˞H/KڧNY͖=Tu%'-Ƽm5}mBZ޽УMNn8\8Eӊruψ%÷{M7ێ+?wm{r}TQ=Zjr mrF= ވ׀cܸeز=ىroE k "bV0C(ŸZ4kȒcN;2 epo'P-¶n5emřn)-W-WƳ"8Lny9SI:&pwSZ8فm|!wJa|<1ZKv" : jml1䵪AwGWۊltZkj v Fn+"b-SrDU~WaHe b'MK_F{I|Z9{ d B>6c;{o;j*Jzc/<{r$Qusv~I.e)r635׷)k6eytwZÒV`cu?/\_Ǡe$~Fs]608JJ8Ų)Jzm7L:#!ge%{$^YmvmfH''nX%-M6&>ϵvtadޞGS)ڜSVܽZL1n;.]m\qh مl`LuM s-Z9>M7f׾vlAgu\oȮBDmYvuww^h_O .O H3Ϸ" k&z)mkیygX{m|k0딷8W"z3C*6DžCt;U=8iAy2S5sɒ;s7 ۈ)xrkaY>+.-x m)=n-m%[rW =bYIEkvЧ=ӛ`uH^x_.f s,#c֞@(lOChSnә)ݲ _yeNޠ_l[$W9 paghەifyua1cc!g=ƮobW¹~xuq6k-ΕL-ݝOl.Xsk2un4"A-0~wcxS[ȪG.*BϋKSY xuټQiyMMb1s!a<@e pׅ9eɀFvc`Ϸ4V+n"mf)w\krWw̋$b5m:Y\w)2K<"a&ШLq˰㥇7/^Omm'v'>>4y64^:)^8t5p":ge.Lmo^cst j)x-[}ڛ,2 22dE_~2"Jx\l 󒝆!Zca?ìc3f8P+w8`/7}`>K;\w{57!^qkI+!6cZ\y1NEf򹏯+xx, d}kW9gzzfj.&}㷒+ASE!Ϣ;#>qo'y5f|gwwI&aH*IFHtk1$/8Cr[]4y:q=3{璔<i7XF c`k4=WgfNm 22ñ2_TE%II^V@oX}[JZ,|mfo#+&o3¼?bM.1I8<ŮJ=`#]>Hːl[nLGxL-mMbm2ilvo-;rިD]rexPtY ǹ[s}=|x ˱"{#Hzx;3[^v-͎p~VfİU9,'r#)~8+p),ZM xKVf5bfN͛?&S4'd{yug7~ӵjݎ5m-֕?rX.->8 %vդjI)d!]G%.0;tKdB7mwzt]ڽMO٢mfe"3I&"ܲ80Σ1׶BCHS\"ذCbMr1mJo憚in"!V(*&Ŀe][߈vwNe%+Z,AX*;OṤ,-j'{#!oW"ߧ1ugRbnU#REb4ATDུ=jfC2N (c^)2;\Ό0Çҍ "sb"tݩdROo-It贚N|DPBT_8֫̾32%4vDzU{n+Tj`SI6YXZ+cnZ*t+5N4ˏ 'QBWi]KӍi{_nBAWi)5l¾-j[Sb{c5u)yyAǗ(vSQȃ}$DZHOm;MkO?cH9(dKE2}Ȍz1mr?.1͸ث8bGpy-sa~eyʴgC(vǖHCg̝Փ_v[km`U>횜F?\}r }ve1r_[>NjeL NAF/ "ɻmkQWsn|e%Lvިt8۔OqJ奶ucw Xy%ɹ7yYyy*;7 os8۔Oq3[ mo5Zi:x!B1|mlry] \Ş|R[y"{gnͬ;a>A1.' GlǘKoΟÝ0kμh6 fbČ\Zi1@.s+V'nQ>zvۤJNU/l~hH/62#|fdmUf6A"1wW+tГ7>V*uVKenfG-k:0{chɳ[Xcwf3/LrQc/6H6dfj1$ͬݕ[-gdYqc($V]+)®M wFWoOܢ|ÏͷE`q]xɅu6\b,Ir ̱X(/.Ya1U%7_ e]Q<ܰ#TY^ܗ\#.emc-k09wdf.7ɒp3h@_ Dm׋(X)_[ƥ^| efwF\YQb8۔Oqߔ̮Q|/Ps[A7Eɭk~"~N6n~m eơfn('? .$7fGXՁoۘKt%6`ݖ0tfA*d\#hMs&X=maXt62fKf<ørprn; zvnm$`0_}\O pa> '0Vq½0ӭۇԒW5׍%:F(t cB pa> '0_}\O pa> 'pqo<"BޕRe%m36~[IZطnA}&Skmp$}76e1[b䃞R_=&ΨWoOܢ|ÏͶܿZs'XóC#dw(HS>t%veyuN0숷5C]= fyvkD*+V/Bؚf)ZJIӔlFx1ݹƳr_,Lr9̃EJT̜uǔY-á;eDm'N8m21bW,2bƬᰙ:۽˫ yʧ\y$x1h|x0 3hT_nd!oydUK>M{o$8EGv4ғܣW_w1yx6W$Btr[j:I}87C&6ʡ2ỐrdI<=}h+V'nQ>zv~MpYfI,˫h\͍N0n*U*Q:~ >wMeoL O~K^*g*=KxlV0BtglaL-Nxܺ*}V:3ӌUa ], AP k~"~N6n~m9G=[k;alȯ涶6΅Q9~,ajL,L+X{2-_ODŽ{jC2~뎶s'-+]Պq- Ҵ])ZqgiJyQE/?grߕXÔZ2{,e)*_K_K_K\P=GnL-6j.j.MWӔXbŮQYڜ7**ٌKv,ChlʊR^Jq*e%!$hŰ*&gYF8apdF UT2AM*o>d;9!^'R띌ecasklzC7\;>pN1kHaD¨ɐ +h-X;I0c1׋ t1, o6عo ,/M- ‰) V^3p[c푝FRr~-k_Zdf>KT(N? $rOn1Os/&<\]j>7ǮELPT?a'[04۬\ bkأgSw&A TNE1IhV#XܳiK\a!nq{7n;_6,r._el/J6^e-b|ն;u6"Oɣr]vS.&S u$Y[s mxih'q}Q-mvQR\TO _{Gaʼn&=b֨8Őw Ge},WaۗߕˎnA|o~1| FYqK_83-ԌY / 7ܾv=w:WN5LV <^u%{zwjo4\bܾ?7/c(r+3muۑX 1O=3 B0_\5Dx0|p)َWe4҈*rIp4e&4j*Nl,MWN+ʎ#}cC cIe\mᬩ>Fq'qnph_Bt:u4`Sa6̤XiRt;5?xXkjkcn7?n햗|V+4)QW1j}Hfxv_qmjZE"ZPTZ줧x~WaۗߕG;baS(2ey vXO v5ώ'tMr76A;pgQ//io~1| ۙyv7n?BK'Jr^g/IM n LAY } aWH:rףxWN+ʎ#}Nuv"9^em ]qXi;B:b|'<ۆVIӔߜb6B᥹1I[pyµ:~*$$sNN 0yHR"~+_XvGlM}.plF%rl{2 hrbhcι ?:9&mr ROG-hw}Q'ы[?nja(˶&7<晔r42$-dF9֕ vO[ٞmzX3Kqf$G=c ;eMɵl}%\ Վj6ԙm}-̅ [;o~1| ᥵%{;ލ6؝'_ vS)U COȼۚ_p;AC]R-{d~D,f-c;]͹s;9+_XvGUU¶g}ae.^kiT&5";i68 3*Xb+;Gy)\曂k/UޮVdnLd _wGÒb5maH"B3*,Y{5NrE00^sPbۚ_pBWgn.8(5|kZ_8÷/*=&v UVBz^\9u#|c>[l Q#rG\jU݆(ʩ[Mۆ/=:;7T.-lo/QQ6E4O5ZmR.9:&+_Xv?G/rH̕74bK.]bHq;lbJ;&8yMLH Rm~ d7zah:+:[K]02؝&L!KH[_9YvNǾ `5 L,qvCS"nTr_zٛ?ӒxidrqKT"gq inUc8C,&0Ylb[o]G/VA!j^!_] ~c^vŲ61 X>RG'm+EɃ2%]?T^La@_ L-к|@< q3W gχ`:w4ͳ\dvWu;ԋdnP}BV/3#ky Ͷs@w^e_a-#u?ajX<යln/_OyC9Y+mų!grOMcM,ըti1V?8ߑ.Ɵ.3^QGurS{r7M9Q9ג|XA[mqQ-wq׬tcOԏ`.:eQ}__d/wٶןS^Z7f7P|B3t ?jJ$0Y62-vۇ:M~ƯNLdQ)tZ{cLcψ|f gχ`:܈dWԵiqϩtnd4uYϖ2c$ud<$8}?\hfZR^ۇeVMܬHpOj9q; H!*&BfJ`= =,1;k =4"|Apv?!|U>Wp/d3 ,MYNu 939y霖FrC>o 9y>ܹd͸YߍY뗑;z.nB\Eg02vwG,f-׽اP|}l00]Ώ k\bq##Y.nXN!kԾee^qG>SN>|?B˿#|=ƾMg˭i;gz{"Of935<..uANq׀A]_Stk~?Of󐍹][ g3oK#F'ԡLh|8-[Rd'q"qpo-ٺ.i_Qk\#2h9 L뿩'>e=_kwXkd"勚mA2f`6N0˿q~kJn3=,'e{wiÑ,f~Sozhy5jG}qݡ>!.B>x}=䥌l Zb;nF>рZͨ>/,B(;YxXba}37*[oRb !d+hw=+var韽9fq|J6w5$0 ;*b%}0М|XZw"XطуF'k 8&E_ʼ,_ۙ2|Oi|JTeU޵0l9`-װ9xU̬#.%ZY3 ׯG5<Ryqgm=LoL~z1Ky ͌"_ʹGvqYXE<=ΰM:/w,FDdS7͇ӓׄ#3<>DRrd坺VE9CNؖ\1)w.Z)u λo`]Ve.@s#ۮ q8 y&? 2f\"9lw:] q8?¹_%}0М|㮹hT]kfeW/[ w'.?36_̀~GdG8NqǨDd:[ԉxbV`%<:pάf7g^ g2#2^ g2O-%f/$@;9kJ37 q|oɺ?d.'6;պ்zG [dFbX%WqM1a# ÏL~ql>bCZ,; :ЂǦ@D ^2l---=q2b V:i,n煘+؋sIx_"“W1(\~7.^47U8'\ѰwȺo^|͌},LWc?ygmgZ?s'خ6[v7Tvm+[klյ}nе3z]Qkmx]nq*EA"xt-WH#bǚݓk*k/D0e#h/ CqY~i&3X%o=ű1$S? 82.w^]lQPnߨb'v:w@oo-`u4oXGMZ@wX;&R˟xMA Õ\AApTqlxݰGSe b1b!I":F`yO5ZV)[3b!SC}v.98"sɼ_mcCxATbKV%:Ha܏r`& *zՀX _ eڎ~ulSDCQ[oa1Qʿyc&Es0fbwmk1gM>s95PEA4ャ1`#4?lsUGA xx?3O)'⚎,|WOюm-$9чHY":ʹ>#90kВ hTjLaB "crs%6_#ys(}_U`f6 =m% 9WXw(:ad+::Fb.(> 5z ,LLaqB=#QtY*ЛѾ3 {˶9wܦW I&>z&jg%~G@߷ E6C޵Ѥte3~- s b1hm#XSU9VUuS#4ezHƆU|^x+\neҭO6PdA(ඎ&c+)7 zj魂~ $!9*cH=#e61J9u42cc*̵l+HƱ8 r)O됯h ˜i"і1d4i &yGO6n|@*l7py`orlF-H?)o X1ՒC˴9aZMVѷ\rk}æGS~QS>em:yjå0F|P=\ȡ>40/3륚|D?}A#BtS`~ϸ{y,'~63G 56 `&LGEz[~uKŲ`7|ƫ"SSS[nO #j`Gػ;Nu>}4zstm롻!'h6 "㗽XQW>6ϗ+sm+png*azFcixѵ6x:A˼3Nəhػv/cR}4p}\:4l#Je|m<*!@#شJbSwU,Z%Es~ث{MeSq~mc1a L`6G,ao&}߯q`uϖ n4mQ "6f;A˛*:},`,SCs4;A>ZNk6Eiػ59_wß|yslGL=_3>j !sAf{u{/b6!#86lICcQGH(a&ou\98B6YN/v!b ̲fSt9dU )B:E6uZև1NrAL 3FgNlb,4Em'G譖\E%mG0ziv}3!~-I3p=嬑 Au1>J85m*.a_1գ+ J۫E"ddiZȨk'޷՗0-Ξ~sǷ @#itfZr|Mc a1yΒvȁ"b8x-r:ʦQXJL2>՜rQk,EAٔb7m}>~|K#S 'bMT9MmQ!VSlNBNmFz -4nP|Qo51PT&+%dΨs 4= F`mtG"ЃOuG2u 皦"Ys CojGt=VZAE UV+D:J,|F4l9YF)7rܘs Y?_b'jǫPrIbhMPq0Оk:3 g㡆Q7fxB)89DU06a udHκEQ21GVXژi{ncZUזX%ZT`lV_Z7"pzENS+MV;Q:[6sU{.3\Nvg1GGnnU dq!3v9L* =W )8) L\B KF9pR5zr*?e (:=h]'0^#Kz" oN{205a~3ljQ{8\~-"][sWw)۔^Lm~HOʎ1 /cs)*GNY;Ø(1L;_9Qr$81GiՔשlDh$\:SW5U??uZ{Q!yk@yׯ,F=#?חk$c7/?9Xe4-yP݀`/6hIvT')ӗ^<. ?XxqT`A"؜+yԑFܪv{Z ".op/*|s^sA~$)t_d}V"ӘseSqV9yHac"x-SAc }`Ӭ~\v7J01ʓڊe=>R:nQQ7 72E̤z}g(zW.jyi%3G?rU3V*z頯a3G"I`]gfWaHyژCt}h¾y^(Tr>U8'\M>/xW9>ZWژN[ai}'.'y^z⤛0en|LIAO@rpOT=L>aGe|e)JGPkaSWڑu䫌ת똊ى5(C.!r1 P2~')9f#IƠCv"0fY`+bN|x@WoUA'3ׯ!>Yt:kzaP.)!wzrw~{їM[>L͕Fjb$shyG+&PÝMW'(2ΣWZ=pN{2 CK_/>L$YoY'*[\F'ߗ W*9:+e},éZX$ш=D`G8]ktQVlA(9,Ӑw #/Ưڿ:rq88AbI9 x񈽉Q6V9 Wcj!~„v<cTާ^^!ęuFS <~ tt;rz}%*fvb(Ò AER~nq_1:FqFG`a:rIfOtei)MO T/FU)<<`~vɺ9PXgQ3i]\jb70=ќ{&F qSK:iT_썈aۓ7eېӠ^}.Tc ,X(/ݩMѴjI5"KS'/%vckN)9FlˆkS [1 ,DCa۟,N2."}8I`z0Oѯdtg='bƺ&vS?J1s 4<7Y)UA.SC S_Pǐ7Zpcݙj\3"~69 f$75b&9v(D۳zX:iOM$kZ{\= B5NCQ4s㘜>`:60d"I&6=̿ծē)0t˘_hNvH_`}3^GHSp٬y*i9@` Z> j; FCBpFXAzSvpWXÜ}>3be S ١5io}~\pBұ5Ρhdѷ+3(6y}e:2aT X?(h:s*Yi}a9>O?kFNb/ 4X%_v2}6 …c@0_l׬=Ӣ- Qѷضج"`Z]H`hAWzh6 vާGMl9ifFrsXr68KH ܽ:k 2PMkôڶ.9΀9) KW'<^tg_)!F ?fw5rjNb:]}3CDCloCgQ2p~}lC.Up .?n)C >[A65yRB"pXj|g#򍫉3 YEw ^_t5ZopjR).M^ul}Y^Y٥k\PusI8F7veD1|K Vc`Aݵ'tz۶t;Umv:>yQyͪq:1u;mYXP67䍦CM# ߟi򂨫A5s=n^m]~[xqZ)P4l/lp||fGRq4UQ9ϠT'F|5: KXM0 +`vf?~Ǹ23㤴:t,^1Estw9al$n^Psc3(@q).s $bHϠl!vR;G|lIϗ|-$;|3ሚ=7QvXA\c>#y_P}9#5XƀC;W6 s}ᚳf'msؒo=i]vi-m^hlLh7y+mtoCv4,ڀX(߳=%؂?, Uf觱, otV(P*g|#vѰmۣEpt)VlwH =K!yE|ju#Oݖ@O:|MЌ|or`&Fqk2uSoeƷhFoƢ)o9[}.&F梏1ڣb[M<݊5Ub8c,~sLEm^{=\(M 1"'K{vfJX7G(*),t ̓|Sa1_>Gy3Py5ڇ̾dbN|ĶjZshyI*mS8;ì,-v.n nQ?Izy;=NkNs}ejmu[ijCۨ[&%b:zO`R[Ystr* 0Mz,]ؗ9ɼ-NklTuY|+ =P$y+O%g>n$pGHѩ!oooE#[vtbOݷv< w ymP˹uP_bXG7yl^W,Ijlus_>ޑ®ib"}؄n>.~T$ԟgO#yPƊMP3Q^Rh,w+]%lD0I v |Y_hZlvu;M:ZC z(m!m0 I@m|?~ {c-6r3v!n[(>E6<¶?(| su&m-&FPrj_rnj &=V6lrn}ܭl^muj* ll={ ]Sk޷._n p&޵Zm6MSoVޭ gmy\?p$[ֽ}uRݦxZk^.SlԵlյzzoXַoX[[ֶslE ̡3ho\c>Qhë>K[_r-bbP6u8:AG~k6at0Gh7e<^SNfzsR*GM] wfOZ#CX @j|ݣo.]5{_:S}#fPfO[4_*٢SV\D p.# ]ToU:fO[4_* p &lT4gδqA{>^V4746#e/{}sgwyX4Ǧ>!%=#11 (xίHxIO!>[y?.SM_`1ҏU#δOl:2EK9ǤmV6,RNafp+bO6M$ҕ!Fa1`^3jqB|~\ξKރ3VU78:W8]rI&6 24itS: 鶋󈱬H?Ze|ú|GCPElI?H4u@>i'o>\g|~[ʂ|ߪEX2c A Ot aW:̽9kPKYf Q~;AA^ysyXA4iMstn&TއC:\ (ZV4}gE/?bNswIO!>[y?.SM_QktAi'#IʨK9'08 #v @?-"l9]kљ ZV>Y6ѱL;M]CsrI* lS gY=]cb ajtjZ'I$(.hα9\< Q'*oZ'AIk簬ƦQ-0ڇ򭽅6porp%>mPNPP[+Y$5$y!ޜ i6mDܢjyb\4fcsp#ܞ!|O|Syג^3k'PO&(ͳO,S&Q>vgχ4gQf (>=#6:)oo߰sO8״_l#i s851LHt }K6C`嬑9Yb aϛ]3ڣ6\WB~\a;I6HE\=QFķ;ݬg-+~j3p8Ǯ z}~0פmϗ}D4巟.3>b?TuIt٧}QzN=:_zˬkz ֎xZ0?~o%~nr447f@E > '`I#ԓbN7#7f2b%9F=d)G#yM#E9ai134y #'Kg<˟Q23lQCyw&O:k|,*uTS̒)WB9Utb4dynq_1:eQ'hc9r QskQ ""F| ~W=wtQ'9Ѩs_AV(ξQ2u |J*D&7GG!1X,}gFa@ Qm{XgAxZH5T(󞬱G e1WͥmC@^K#*E9xGY=]JFt9aӘӠNpr㣮uSHG6Ϝ$qX@:IÎE~|*0 qhguQ'іJOY\tj':xKЫO#~%:C$-q)XB:7͎AU=DNFmB$ 7.V#u>]rs}?HvdP>Q^98aּ87oh9ˋ]"@zrQ9![>Oy ϗ1ro:Z/_kSHj_?MH'(Diya -byp('w:iqSՑi>%G:IÅ#/y8#Z.N!|O|Sy.j\G.\arE sM46IzݷKR^moԗ~m%ovߩ/[{IzݷKL.#BA9'..=YtTɕ{3-)jG4JoyrâLΏZ] %ovߩ/[{IzݷKR^moԗ~m%ovߩ/[{Izݴ+igSXzG!0A\|]z5eM@z=9ngeFnsRRCq `~i4*J%7ONXHen9Ɛt^i,j*ItyjQ;N\6?$^|/>i'o>\g|~Ln>RFUt4`j-Gys1v%ZPWFDf61j;Ka A_/hPs۾V4 sZhmt9 U56FVWM3$ȗz X!#X4)g]l}~#1襷3 l~ :{yNXF9ipSQsp Sn!_cޓ﹎G@dQRL\69E0AsQDj0>Oy ϗ1ro:"W8:Fjj3Mo >ɍzl,I5)'YO#}D4巟.3>b?Tu3>𶏍f<ʲЃ{ bjW ۧF@`9%X^,؞SJcfqfXB@6!HׁE+J:j|1 r^4l(Af_N}+ ]q!iy6M,pYInba t9~řRQS"CsPT=ozǠSm4Gds/^aipE9;$9Q3aɌ{/XC f/Ydo_W=鲤jPaǪ oOoOoOdWR}"r!rr wS[wSX2tG+zEݟ~sߨ}Z?J=AA B|ݑ},%~(n=rsycbp첧>7ڏIb4'ܰҤA`qR,Io%^W4NP[' zr#Ra f)~>cs ׬f }@zN;7о)6 {WPT7ؗ ?Hm-|v_BTP4~) wfdu*hA34CPVr9-ܿ}~n_>Ùl{f!N҄||' A:) ~m.fA6Xc2J3h~adYdR}si[i[x50TP=ؼs۱M٣ 4 G0і >}WoY;=?KFPu; &x9QipQ .?has#al+nhz LFӜg»h<*â3'|cTl_cȩȀ\K(ZHo[\CՓk1Sk1WjŅNQڥ#e:c`***+Q]oR?a\5p#Z9B,h$:$ P9Ȳ0(EA6@8Tf &sS\R?r_>q.:NQuk2Y[Q_v$R+Ai֓FH )`Ls精:dáP!GXw#sTݷѼSgcR_pVwX+*.<\y>&g}nk:7;H|^nr;؁p~[zM3xE< `51R9W:]V.Fos_[a, +4i1+zL wA|%Xܾ%$ʘL[Ҝ|&:SuiMl.SmӕCψDcG~2m& I8>pstqq/_bU*nH97.~LV~ yȏqu#oHB9h3PƩ @ %5xPj m<%Iì^c(=Q֧Hl&&2#psB2/_ʃ} SއȻ9GG\*SgcTRϟ?KFPu~/ksFtE7.YfN*Nh0XeQ9ΒvRvll'Q{70@4řp$h$oIaѻmx@:}*L@뭄01ƻ{(+.w+Ldi)c%-+P5h]C&wo92'24N/&faA_%o@GAc΢ķu*Y8 lid=!)en&16Χ3k@ir-z4 mΎA՘|fдI+6Z)繁Kܿ@31fٗ q4;nT0iI-rZ\f2]KҦV(@ 2]vgU_Xy$**I4m6hx>0=h~J bm[x(ԡTy[8uʭ^W$^? MJY#`EA3 =4Χ$x֯SpSp43yB %^95#ud/;X$\90ɅHWPǡA= McPlgI/1PUEPrh`@Y:so/@X2&`z}nL.1pP: 17rfgڥ#e:T|0a$>c,l&9=ᥘsSc1oJنF?|Ԓy 85\A:aİ| ˡ6u@kb34Ibr) Ђ3Fch`(mB3Vi$rRI'i7N\pL+=[n6 i?lMAO~;c9qrW!}G9cu41X%ZT`l^ h+KW#RFPSԤN;8ڄ^vpfˈbFN`hiqaWBjM_cdDV93_o D,\cTl\Wꏜr\9#ӗH祈QU ^Xs=¼ͺeATu*y7A$ږf= (n|mFo4bGp.Or~#ps Q+#4" c |sP.$nT(ľ~n\$@؀z[G'LE.\Fv|+SEYoݖ =\f:i]|xJ$YSE.E,l)A %{&'CCs >18# . ,nOGez$Yp䁣h7H6d6A|LSrӡ:i340H6(TRXl,>gm]{ZBp(Jn^hω|A]98O'9p?QvʒԑH l6:2*Œ> u:rRmkSx dm޶lPHs[܋Ӥ;-|?jVc@ѴNIV&A=o<r/_!8~~Hǣ9;س!8.6N:G:gg@+G05[ⳏ jy-S-zymKm(l:3qkE|"W^X\M0.Or~0Fl Y]"HOg8`ur.y7hpydt<ũj3 /0I|}`,xIOyIe`TOڸaǽyjGHq= ~ 9'YJ3ى$`H%= {=>+G1 ,IP~0m<"kV :9K3Icg;gP:H P~OQ̦wFl&;,33h< 3 b>urXϹiX>_]gܷ.[Y-DHAv lV CGn- V\|fc>˼ClûXyWF\՚gs>iʰ (#3XFv͉&P1y/0#;XX؀I~),U >?ݥo=iFYcMT$Df>k~'rݸs=^%=fќn9ma+3c,1sl"k!P3sXaχ󌘯>X5_8YY@.>"ja\(y#Oخe^uEciI{>2bR1o<6Xby7dϺMn+x#^$fMsSM,awI+b*w=iMFsӠyyx]䥻<Pg: ֥XqL=#ܴ%4Vep RdJ uia-REy@г^sK~?$ui<#Cu:Mv[0h$1*C B6Xq=#ܶ29>鴼pg?@`gPrǻİ;@>巤Zn#. 0ўK`cEXͷ7zF[|f4uYXN̠$z1@fޯ]CD90ik-^abJagb8|J1 PiW]%53ȏxf_8P[ýĝ/X`Q9du!pl"j@5w -1EAGRghc"9rM23T_]Nbiy-3y'͑cK9b& uSכXr 4sͷ$pch~/I):In%m{ 3pa|&+$p 7@gc@@.1gt7RsV_Y$B3 fhJH'htgVқ>?~JIQ$,e6b,(Z<1_X|}j6dZ(}eɎ|g<=kvQO"͉Ed_]i{ 23x$u%Y#`P"YUEX{X>m%=:,H㦗 4l9O̵Xd\ 9 XPXƠ:} bdǨ d{i06 MCG&o wRv FfKy$j"if#bl؉)݃fV MH\ݡ,": {Zra>~h9!#iy,ӶzadXt]#6QR~}i(5n;nƽ`X ߲3>\skK<pj;z3Y~Qs/Z.fMO f_ /:tiz,;%`3[+FvYbj:Vs1nHS"Y@:sǗ󌘯>|HJu=9p9RDEIAQP&ē}]3lW՟5sw4o,z=BXkϻfVE-wiXXh&"{"l}|psOP$yig}@Jtu&ns9$i=vq #1_X|$].iqx4r) jKp0Vϔ>ql_79՟8+ϚˡX`;=6bJ)#@f_5 +j6_ߨ(X1sYf$a€yEX%#E3 Vv߬YR*h8^aZpO]%G1%Nãf$ 40^Z^uacާXNcgu90W^=i&䴰sQԆϑ&#aӑD Jzu6@aJ=wҥzGx i E+(ѧ$rn I/fv4P*yf'R> :Z+ >%UɠD E sn7h,)}mvin,'wsimYDZ)T^8GUaylW2m/:Ţo1$2=u~*tPGAFn^ӰF:>c |y_8Rv6$:CIu?{QV:L0ox:GUIS|ӐYb.ԥ55TsRz oG+k ZHpY)ZhnVo2$Nf#צf0b (:hQ809~C:0[{VUm aWeVhQϚɅ I5s/=JQ]=lJU+KKξq0'}vh՗hèmyEsX3hN,>P>6I4u5d4g]#mYV:h^~=F즞kHG7 C7z1k_AVHi!ט,IaE8d:E * fa}fd8IZ5SH􎝖)"Cm`Umzl9hIyؒy͏t{ѫ},plj>^a&&=Vi7@7?3ZV_)ċ\ס̯7vf/kퟹUGvv -gV=vͽo -z[9ǰvFi칷hn#nʡZq[. (21VVXAz U_ ,M*Oجc hM:^9:nVU-~YOw_3RT, ŜN| T3צ,KSm}~mBbBz 2Fz'o;C?Y>3_@YAXcMDvzf "Sd6H:W^]AkũZuU‡xӿ )N_Im|{a8;pM"q'wP-M,1xSNR,WA*MB/Tr5FhĭTqYı%d tu39WFё _Eg 8#NcsY'# hwhkKꢗ~4rYpAsI\Bl61s DC̳ƴ'Bh|p94W#z&?T-Eb@&>')6 *> WVSZ:qf1Qacc&I%bQhq,Lsa$P*H CzڪnO[bǑr2<[ )i`'tR@Y 2p7baHHGzI^H~ Փ %ZBֱqc@yF ݫae#x^a{/*ѨUM6EEb/G}21 4.-T[Q[}VcorYAB(As5Z|wq %gvۄStvEi{su|-DGWt GӻK#R/x [ 'ip*c@}E *Xa Ls`P* l}|ka$xbQj3Wߪ=pz=oN=M? 5bm #6l$ᕁl"_J0H~zC! ђnhZ~|^!$T#C)eaz/*8YpNћRS/eWPqNݠ&#Ց*iZGcCL$=<ث pI8n7gFؘ1*5lKayzňaCʮbs&-{/_tyF!A.V4DJUo*jA-/jNC@ tb=]M*)5U0& }'cJ=(/odP(G7r>5"='[smè(DUVRh<% iN}smO1z!C#""؞?Đg,Ri&h"ode1ҍ> dLUԫ ᔀAˇ`q2' +PA-׊H|Q@rNJEI/KН##yGoB^: `0nb"*scHF;t|5zyw HґUo4̓N=^3ei70FRԫgE=t:#3`@ȮCPE/N-raLnB19вIn Ihd#svAEqf9P2TX [A:knVۧ=+ ,hoz};3r$/1ȴ;/WcII1*(EN^lIԲ%F{` UxɅı3C)?}VZ2cQ>Oۜ;OzґkvX N*T҅Ʀ*gNq`bT¢ef}40&+kvFͧw{em}~_rSaθ@2R5j}LFlY*]O>(G.}WӜZSpOQ9 AipD|s<͊!py $:W4he' 8 g- t9ެ(AqԴeQ̲(JQ2RCPFpmq_ERH=tUl1lC댥X\lTЏðr1oh̪ doŸjqM?EIOna=%Ge8H41YX;yN$޺Ѩ밚AF]x '᳦y9ՔѕVFq=:{irʣdQdԕee5VV *qY#cE90A]D:ZVx60đM-MI5$O"XLl{j1vh6N'x6"`[{B]C.#N7($τ@dgg @&4rd9OAi_tyF anqG-oƐ~N\w8Ub2h`YSK%RԸK@u:poLVE4 Y7~n9ƐunY0n` Y$_I@/,[xy HYM4*A x?b)q}1 CP h[B\ =rz2 p,I *O,!Fz EcuX^#CȣrՇ%?ڵe7P1Ofi$pM~!Ż~xZj3<3*TÀLX!UqvQ!bp'i͋G@iU!uTVDz:Px i؞7NVl99~(1@Q*lG:\/ѣPDhe9ԕaz/Z.$ fK4RYЃHna{GlDՍA2Xz_L/@a+^V5QV}UrsRSyrk%@}ȨOH8/aR\@)>Q ãusj9,hh&/ * ʈYf gpv%k!'f]KvtIKwDV7ٸDxqlot9b%D#*7,kvg=lI!AI_`xw h\TN|뿺s~{(o.*gp/K"xYKaxۻ 1ټ<~+qb"%+HL m,1aj2WCnv8%ГZ>mTmAan+}dcbQ֍s.c#b\~}G5HphAїS_^Tf86wx !Gf A4t*I{3 :-rpƬ?i+A,f"l:VtчiEw3w?t:hs wqFp-PGVgY1#:ǥa%$p(UTPp=\7#R4AFsvdZ7\?t/jLDWQ NȭToh3HMPP=,G'J%nbq6wN䟋^fyUp AA{/x:n*4)+ ) _1^ 2R,hM+rr/^.۶`F˴e^q1:G]N@TQn'*ajPHs]Ha}EwOhoqIbɅ'2^:QRjLE]UU%9:2[P> @"Yf3o'C w٠`w[TޑmGK6N"p>φ,TJzFsִqVÿaڹ\{.xOjvHoO$2 *"qNIS!GGՅYMqO #RK>+{D9 {ql L{CQ:yݑdF:˚As G9VA^9\(:1ʟ™0.ut!`-EF,wAA H?v[FR4̀L3̂;3̧R bCtEn-n&Bk,=QӛMʵVb8_#Xʾ# Ff*A hPc\s?AHX pi? RDaqH9ՔѕXRpK|,HP(֮W^SBh$}Ø٣uFS" #V\n n7l1]Gj1TS6VB2$Y4 ^9O2{@9ЮR8]#ۧqxAޛQF\: 1%HBU@UpT"J I/$~Nm&Ʃ!S n)pf27$όeK9oip0P wF/wg bRleuaUeaq^'_(f] *7j"TT2 wG'!=*y#7aV"*Acz2ňS^}c]hT}c,GL-G#@YUGl\Q;%iw6 2.fXbZwF@j7Ü4aGcsb]Ζ& ɟ"ą܅UUff4@M L=;f+oH <p~3$2g%f&aL ^Cx $ 'JofMvQu)Ql6 X~7e/zz(pql8.^{ 2S7*I  /C^H d;W(qvU}w{h/c/xvd8+#=;.'3Ɉ31,Գ1$&}b~\0W&/0NUMuJ##Pg7_\I3wSjf7'XJ9eV  i1R8ggv 6 [xg d7p)!AnVQaO1®}ˀ|C Q7A((T=&b%gHřjII$-Gi 9,حze+&@Vj֣Qۈj0MnLIܶs85kx 3bƃKM$L/rqc.eD\ n%LnrOw]qƟtVR:$N;jnqwPn- tq8kzE(;#m/'+ƤSt!uXӑ^RukBaqЗ% ӸHM݈וN8\g >0&aq'fE򋏒g“s .=`^9W1JzDN䝋2xnWw _hn ;teC+.~ op 8*7`*ci 3DZW?xw@,TvQIzF.`-xs5]Jި\>껁ی|pW|/8 \^XcafGRn y0;"]NROAۄ?1E2JU6[xxHv:We#\C<bq Еǐ;u HogeZHV LiRPW\|w T݇m* 'ubS>^՟1d2{[ž).x3}+n]$oxd-REphE 3I?u v\7(9^"oG=F=r^2Hӵr$/NG43+G!`󌮹QWR.)ZwFٮW8Rn&R㿈=T(p5ˈ2WOUa3,'zi1ǻpR7hQkNYxSO!H)$!XגL\Va=;(Owӗ :|LH3.oy4{/rx3M_u<=W=2{>:Dw]-Y7aîp9}ť/۬ .\4 _/ ĨF:35zk8j>6 +ZƭceNq\^*Oc09F4u]ŷı[ps`sK9%dcu Ci~r7e:dj8bH0˅#Q/?\ wFeG ʜ+S8lK҃pk>h˅Ɵ[_}L,|+SV²$%zwk6VAN}œ._Ƚ+E>Qv̾ TdK;$ O 2\U.C\pb 7@(5k޷?݃~_ͼ -D92ku=jIީRk~Tlsjq,#7oeP/^W=UN~N' (Rٍ7MagZM0H"Oݙ[rTj:1.2gH͛F|ᒂ‹uooʣfV;Ov 9΀M=DP {cÝ*hA8OX$j+';xLSg&^ FMv"gg}$eW&3T׺fZŇYlU7ꑓngfW1 AFb-FARhg@]yW=TVx舖 4ERFn"׆nDKp ԣO/93Eۑ|tݓhWHAg5ič9X@}'Jx^-j{}MFĠPr|E#w4iWu9..7u2ap ;NK@2Ջ􆘩;2^.I1lpҎu֛%0[ P 5"tz gy<3Ƹ8L33PJ#*F9ľ dY\,JsI;W{[rʼʤ(_Ҵi+!ѕ>Vn LntoF4HEEW\3ɬ,a9pӻĀ/|1bUav5v0> 5@wG0jzrˈ##Ps/׫/<% bX2dJn}2tA/g8/ H%KveQ[E<+XR*"rgbY0ң#U 0$n خǁb+.CSX6!'q}Ӛ@i!}Sѕ#AWb7 CE=&#ɽIuwP}ZNw9eJ&‚DF`z SUiBn*5 -7LK$n328 n7WXH5Q/iX=XPox5pиfE?u"ʸj94l n خ?x^&jσ4X%9rn9ЇI /- am׎E*v}sAˈl\5u,Ēvc >G0!E;;K Y:K_61cȳƽ -[Ϝ,x#4uf8:3)*)EPNU299϶5xF`Yf5ip߄w//x7L׾3 vģi;/_Pxм^je7)$53Ňĩ(UUUUE pq/wh+O7J1q\?].0LO_9J{AgQ 8os5aX07sWؙΛ>cSXdWGSFGRYHAc]|AݏPʣ_ʞV;1X4;MP9HFk:pEp0)t/ ~(  "āUUUU@rq<;a#2xPsV-^850.Y0"{Ʉnx'%қm>if5brqvt)>e]C)bx n CBSüC"^yNs28t`Uַ0"^/^!͆cět&Mi(; $8ȜUєЫ+U۩hZF I&Nal/|%Q!C@Dz2@V;|rjaDw"iw#TbX!^7-qS5w"zF4"bvby@,YO%=>je #'o+6Ttณ8T^1`PHf,l6;IS":ª 3[ hPKP\hzJnNԞUC2}UM*?\Y$j}{1"/ qҽ_uaPtw;=Q,kp4evhf!T@b~,X PT%\*)!jy?al;{sg>UDbhl(oc@9 &1}쓚֠)1*﷍ Ǧ/fB"wjQQAbs 6°HLz0zR+@;)*%/P9}‹qdÒEdKBHV=(ŋa8ljᓭRD5AgVSs+A |S@weQ&BEp x'čg ]ͽgcK~!\DE>*4,CB eUU%9:nLDXVW>>2W'@,G|Ld7wVW8fc|409iXg4N;bΧ!i+P^VnӕFIbp/;# 2է E yj8&A4R:*۬wG0X#֒g&Jo:6w>CNYkq 5AK3O hItGpRhܙպD_{ "kz J]q_|7Jm$ҽ!ZGEkb2 +uj+6mqOLkZi,7| Ѧ1TAx)`qx];HFa2y 沿 5zQ/51Ayʭ~N`4YG50pRS}ى"I؞ උxUZZaM ۈwJ+#.+j9:QQ@U(SY I6 $aAcILhQ@ (Ax ɇ0Ie;.#1$[ u\>2\j/9;V&:]bQ[C\,22+)! k/Xe&8<ZV)$u#3 Pbe( Xu(w_n[; I7cÒ07j'@S[?8:{xz298;,_ 5^rƃxL8%0Z!؊]ppxSPqSiEb[̌A,l-?q8Z$u1,u^s]iepKAͥ@BK TQ /v3 r.q͉4GR!VI8_'&rvJ!h/':ȍJy"> LG_0ԞZmvK$u?^wI$f$wQTh #)Y-/BlV>OZI]vg$hNIM!@ܣ0vSZ i~lwPg=ϔ:-Sg|;8,EELR2`ptGV)W_dV렅oӪ8/1&b"%+H{l݆'q.2 VʒϸƇX4 ob2(0;9وΒx10q~s4<(/,}{ _,\s=Ȇ54qW\Y&>'ȼ^K4YAlSP6iursZGi9YIVX"k ѮeLBAJh8 s$RI 欣"x!%k¼PMEA0G):u hoBhlR҇_q~pN)7nx|,\ Vz+M9ſ밿K~2N;ğ *o+ 0&."Ǹn#7I}cZ]V ^2m]׸f^SNv3^zSmDna3݂:$ܣ,Ig0~{(Uڃ>ut}^EPMH=65ͽ#]dcE|# c툓ug+Yh9Mo3t碝6 AAT_oml8>=&a$y7 =&Iai$־V}k/6k/6fk2M-يBy7ǻMHQIy,wlͥmdחL<%ì|dä= =*w`n ?8'a"IXmI I~.n蹭ECuY|;fyTwxW7GYuA}l H)孷"Uu57%TPr7= W=Oy-x>K^nUN] Am"1нŮ$۲vNkTb-A-/[6 Coz'(p:-{^INbdG2F97Rۭ ^æ5#fo!ݤjQhut_T?*qZhWF̤o,-E73+ux&H&9Wc-*; <`&Q$m$AMve a^ Fըn7d\/.ڗ KO/5+'24PIQj ?![4Sg_uq_ԇxXPfm'Fг.ݷ5I6 Xuy@z}\&'Ux a19x~ i88cx 7Mri7$u AWWW#ü <=p ׅAK/Qfǎ%rfwTv#ZMM٭~?-~?-8㢋eG]IܱPP]ܸxm< HI7.ݙSEL@I ,bڟ8or7o'.VP^o b N7{MdE@dqLG &:AYMUe`U#$O4ab*Y.XqtRc%" J$Io 3%Q0hO>tĔ'"LN*tUFĀ9G gSKx9q+x)1ɠp/1n~Nk_!c@"ŗF2p'$iB_n8T>cu* ,sI7v7`፞GrQfbn IlOS>q=⊛1G \ '. n p]VR o`'>.$EIɸG8RRnYBBW|AL7 Uo7Ugv7*(,,+>`W9isJ ԩ.ʃpr158ѝUPXah~'C0m~ FG—}}u'7ͧZ\8݋)NO\N}/8x#vo|eMuhx _ ݯ?߭+B8BE(<XxFI L*$|%̧C)*#~zÆ/brj9J4^I9I8n8W `|UDè2W7{Acd~;qBq\(CE,В=*GM~#`7Su dEKsRIRfoJ/(/bP4&'pビ :./-/$pm(㸼~'JEh?xHϺ+@pJ_+K143fªzևg?1yI11Ђ<ţP('gbLRМ)6p- "j!WMmxyxn!c]g9`x> AZn0M1,,c/7IfA衁F,0'saT-_Ob #߽$L"PE06ab|s)QcH/). ¼A&0¬E7 BR &lSQ4F.2Kn. opP$FK򞂋,c>jO)WLX7i z7x#)뭉y1^T>u$cLt~q On`Ea|ӗ߱9p`?ˋ{ٍ 4eEcEEgeS6HؙQCQZ(8> "Tt Ĵ lWJx7S0ѽ) . ɋw` 33P*I$&l'\"$fO&i7ؕD$ p nQR"ĠxI/NA/ gĠ9Kx$ZoRUϰ';"F4dÆ$CJ YxWxLxl=deh9x0Qb0"FXz?' K:R[ ƭ +) 9raJ|Z)γ3CȈth2qhc@p)gP^/l<|Ln"WF9݋3v$D淈b&+={l Wp^ L? àHA@yKVfbYbX, #Q8~/هp.3wƌLFњG># N_~Ճs88z Vc@4<$vEJuKfap6$l}7|/@^N! /01 ] l i9ۘQr1p4oN\?X?G>_p4]B )$ X*xWa c' ҂`N<[c$3ct`Nww2U9qX l+&x92:e;Ia<39$.Nv9q?%+f({ E38 i9 1xWƏWtb1ı3qTGI;=IݭMU*ǡ7pDK$nR9oxY 'A!dtġ"9x؁ HBXU-E0`Z J(U^D$*'+) j 8~@|Q Zd rޢ'8ĸh\F {FꚆH7PØ&_ ۢbcw SUu}!JM6b_YlI3 P /)l0v^PŜi8FR38Mv$\gI"|=MHF5,ra~y2Xa*H̓s#F|># N_~Ճs$N0ECIMḔ.H˾!R*7F)QZYO3fcrY$I7so{V?[{oGVE 0"As`  ]$@w Sjh *r5Q8w`c?GG6_ pl?ë|Kc>lp OIu іCu݈T_C~Y$O!IhLW/pI>,~ıIyexsx8~$ /.t5*m{V?[{o{V?8È9wN7_W{4p 7]l8or7o'./H0m /;qq1$M]TC#V[*"Ppfh/8I4j3Nm?g>^^bb#X:3tr 3pATi:ߘ?/{s =q76<%^%`qpI ZHl4&AB1x92H@> VE=њsQ Wku'ŪKSMH+wŌ^NǙp H|:0t=ek6O\_79|7VϗӃXsCA#ټ3T~l|Fv] +}+MV  KtV)cKV"᧕aHyHYGM9xY0 3@4 ٳog^KL7z:F35oT-ʾ9m7Qڛ H/4%O7ɉxݎ4f9UPYPMgea?d$kBeP VٯPe^$ 7 Ŕ$*?¼^'3^lAHP^7ԚTW/OJr\bFXJ~zÆ/brj9ovG56Oz~1<{ R`v!ՅE^{gk γ5YCoa?Xmu?6:gk γ5|HE{.;ܿx!0p=bJ9$, ]C^W{chW|C6c0U"er\b G$TdYCoa?Xmu?6:gk γ5YCoaۆ.? :Kjx2iTGiL@V9DQ]aqg&9i1%joi0g_V1$R* Ao7^dU>Y(B!@gzR(U|S$KSD\dfˇDVV 5H q)5dAV8IOpā1d3Y@奌?3 `KN)8[?DMSyMe4dozx?Üf?74DSp\#~%$q304 6FWǚˉfy kTcCq(H9|K&&,3,:4tixUc/}s.F/朾 ˇ'JaG}FO,p3.!&hNfGYN a?UXɆ5Ԑ ΦhOye7(MOs9ib:fA\ 64mª)C) F$1~6}縔bnFS< K):Ѥ2EPI ,,AjioyG%EMrpKFBfrF4F*Rh+* dA*KPKM#ree4e`oAn<ԻG)?1;.*{8|Eʳܨ1#dA&+Nv* $E L3ڗQ]m$)WdrHN:qcs`8fPA E I)̪ IZd<ڰ;P&CCl)!N'`cE?[Ax ãcBcӴK19gbIpGGYMAR B.6 v*M aj&' 9 dq<`>'R+)4'zVVH#1QxE1qT@;Xndj ۲ꬳK' |p.,`!4w&#_ar+XQHYADɻ& .s jQbw&2|g`đYHDɍ?R~zÆ/brj91agIcmOSQ]n~ V1;2Dc2xTrq!-{*Nuj$g ̨3qN`݌\ $Vac$.^j6"@cæe"F<ٱRnK*nɈtPA kݡ$z-g`pDŽ񗿽(&3ZL}ӱlQI|(i($TcV 0Xl >ωԨgu Vc PFb5ưbxlGE s 2ApI# $ӻ6ʲ=iXLS# :hB4lB ˸I_! oG,4L \ϸԡ^!лԲߕj*ֈ{sq@0h N˝MʒhO_ xoR+]*oP8p dRS9Fd]Lt4^I9Id>4%Zb$\.$TVJn?C4^ʂC#C+ZS+@uU@.(pXSlAi I@i,M~6KSz>DX=eN~6@L&B.y3C#]D峾ԒI'9&f\< 9T-y*N5,^Zf*oh/bp ++F"@p1@q2ncT]'XTQ>Bތ3 1NkS6IzFh+a' kn5r^H]_dDoRw4?}e㱓ɤgwcVwrYI'I9ۘQr1p4oN\?X?G?"OF8saUdnI~ %@F PFb5 #QMļXԴAMkRp$$t?V#K$?XC*3oH:ZDfK$QF.j/| xHBI3x(l&S@)Xz%@)q4uxSb XߊnY7,F;+x M9IP*ᖻifO$RIDc97+XU>^{, 852Q#񴁸@`vyR J qlWxB9یOv$5enMѺ{ߎ\OP,H͇QpW.VHQD* 7<:eIR9b322=c'`}-"#?t7qc^[4"82"FrK1f,Ǒ/ ;Ŋã*j(Cx>4G@G1ŋs,s.Iǻ"|JXpݫ# N_~Ճsp^ aWÊ#K@=дCww+ :KC# *  ^=b <A> {X޽ϋrK333ĒI&y1b0NYIVVSPE A-H8Ej,S 9Xxi߽ݰf#Xbx,Hg,@\#aaUg^yMM5,Mrb d '~%pȆ45 V-bH3D4}NBNW}}ĸ2<>,HQg,ƀM/<2g5Y1la􌊱I(Br3]V5xnt}$MU&:U;|lY䑋IbtI iT8$p^I 0?v0``?bÍeuSQU$Ti/p1j q$UYQx ~/˷_h \4wc#T_nZz5&w -b83ޱ9i47 0}sqpj R7TaSGH *ðN%;G~Ftj3eoct3'@iv)eVX Ex"m~6?E>j$ +Z1K8%=ܛZ}+%KWXsl?0*FVmW^Ex;sV<,UXQ"{ 0SIb,BF*`AȘ/c5'+ae4(nK(7Or+K}K88`4fA<ݼS tVQ|HhȼCN|ѻa|A,n0VM4Tf*|B4bg1-m|T(7RGH1 7pK2F:F Qͽlˈ-Ad"`23hfhW|)y[qI>_[e]ٹ2KDVV 5H q'8x8)r tG(@N7,t*i"Tz}Xp𴒜ʠiwKv[ǸSPor6p`G3G!YNr\8,43 i!zVCXOWb(@bAHXT~ECXYi4T\Fu ԚO ,~Ӄs{~/NBaI06eF5&协>98oG_" A,|c AKNvpE,۞;& RoSӘYK|Junצ8x)& ;kx6 Y`Č}H'H` ڍ?7sƸɠ0Gٔ7]?Wг@@H<֒|?V+z}KJNW6VYH #H"X=1MPNxMvVo|spߠ/iE7_ݢ8?G6_m_ܗ^+q`d \ QJj0joG*׻3А9M'|=1ZHYU p/Ic:2h47*^#88\ zJ5 @pL?8|Nq1 v3J9kb8X}?Kxt*6mbux  +C1&]:uy,&9Y*H%I$\H7T\i߲A2J |.3,Xg)x}#w;QcVloC7 ^6*X5\Ax~ Xb0.h~xz7(bЃ,+CrF#\/yXqÆpGz4͚5*G..)x\zfx؂GaVNm48Qc`Riݝ91_p8%5n5 h(BDqF  PH$mڑtPsb,|AZgx~Uq0q#8n3ҋtXu09'r+=8t W> 8l9cKuE! 40F&NF+)6.H1HAAD7(fITc%bݘ,I$'7dL YH `񼪼VNH1T 10 #u\HV|O9^X?i9/jⱸxpN%ĊfRaΝmd`dP5YT,pWf) Ac3֢%5 Tcq+wrYԳy$I'U-`vF4 rs$B!҅ϼhI x:P 1\gcfjU\*ذN,"9 Nv} VEpbqKk'&?f} Z{crƃKE 11\c@dz}Wf18z" $J5`8Ĭ7tqg e7?R~-x1ħ݌ ޔӸQN3<`eSF&Fz/':DAR4r ,~Ӄse_ 7K :i*+NҺ3 &G6^+.$".@DG*y8L\HQ [HxLX9)DƎbFkN65p2\L@s,{Q1T$]F@$@H2P0w_l/OCqHbqx1ER S,j*nXpurG[Djޡ-RXn+oK1U 9G1n, vFeP *ՔQJ(ˀO/e/n_Gq@8&S~,?0VY)㮊5W0+qQTÂ[D$.jb $C) [ SF̡pǹ`#Z|yYc҆19xq1:} 5Ē ^98oG_"8J5>Տm mw6ym&0($V!c1r(d`ATs4[ļ1L>=}eܩw`qBo ۓ16O bx5D<1li&}aurF{C/X[ &TТa:R5=?'D $GhXy>V*3FSW?c`Ep~l ڿ5~RT`+>! F+ BKr L7auC#e*8ЭNœž )v#V!^F_F[1ѐ6''I\3èg9>+}n$NUe2?E V.(#YX g6\ԧ~v,|~krshGmJ ,s(@qc*% t \)TwB3M0݃/"abA,1n.'>"$TO1c S_`&c.:yyTlnv10aV#ߠdo-bb bT19"{ZOdSy|EOB, ňG]L6_ܝ:.BpS9㯸 sg/Ÿ^:9/4cӗhqI:@g )?KSrxH0 BTtEռkz]huM 'qpk9U݉rjIsu}J|'lhN͗W&lV*t wv T1 (I >xZ *^*E753P٩# # H$I-9c'{r Ov@roF/v9Z27Spn(4TI0H՚2nIH yX_pbdeCv |/7lR%]A7o(kC)>|,QRe~y.bX ?HGniuUz֋:VR qNLoCYC(uYHeArA_~Ћ/xSz| l݆Ir;4a'IWQ(Ojn !2`1ѳ*!þ΀bs,uY) s <~6B A(+5o6Y#`A A䧃s^%C #I;(UpR4r ,~ӃseⲔlHy)b*A'>`-|{ȶKf4̐( 1].(P5]ء/`R1q0weZo'յ|O xU#P [.TRP 5iC!6E:0taYIVA#!$ bxWqcJA];x $q4$´lO83wrK3RI:xRL@8|5Gj ΫB;f%8 fx0SzҬqiTEY pY#x&Xpaǽ Xj1'rtr9i$-ޒjDY~.xy۱19Ԓ \*!0*,þ;@NE[n3 !6I! ñOUvG^fRt,xb@U!G!9\͞<_a?tR ,wli'VyĖbsMI'I9p ""3*KG+qIb^7ىN.⁨2xOo|RxwHKAjRd {)w$Ԉ܄oʍ܍-צ|[5AX0AX15[T>>hx6 Y`(8Njdu6 Ҹu+l?{;#K5'\QeeaB q؞=6%]k&rЏy-GfZc `1`&ĸ=CHѿ%/XIU8'/CNi)C$g'0EP+U*E 7EOa^~Ĵui%$9xͼ8 NX̊hAxˆqoyzIyڗ*UUxA_~ЋGHIBeLU=7d4*s2'*+ e4 7 1BfFO EI >;'tEGj<2HE(J'`Iؤ._}NMp-Iv! H !e m&7b<'+tSq^$+FEq\O I#E PHQTu0ˀO/e&+1>[uRPZ.]x_ʷ/V%*oXx7ih4m)e#eTUU [/_֗%纷m{ƺWHN4tIZ,V_\b֫!c >6xnQ¸Ja74Dw@m#b;.#\5gBv!xl)ceM  h/hWN*keCL)-Ŏٰ>i&!]t"Z°Qa $qDQ@y9ɩ5''5<7I7c}eXRY nfi S`ͼX[vZ x_^b> meXV4A$y}L@:wˍx׈-N4 3acqDQU@lŸ'Þ(Ȁ%aE`*Fb6%*o[`E¥b%{xPW|QV2Љ| SI6n^3syyp[b0enp>Ź4(*i$4,OƤM#UIQ2Z;c T &~@40jUy>xwO,+!XP HK*Ux_ʷ$ŇZRP¼x:MJ:FSq A^ƮSyXN^ӦpE/*Mݪdވ=r?ผ\g X1c hX4IEckdb.C}|5?bvg؊MX}x_ʷ/V%*8h5U񿊿o^7Wȇ::A{cwp>!uKI!5$ן0w1tiUPS+sn}\2]W VT5.x<ȥW#m5Gѡ@:L)$-XS {+TלN)xSFm, Nm(`j;q ٳ0й:oC[*&jH1e(cbI4߭Gݰe`Tp2VZR,>F {D fU;H{~v݉U> +&4R뭋@G߬TY&]ե Htn~iv1@&ʫOU'_Vck?Zf0}_H搶ͫ7MLOy^Ѩ4ufȠa'EPzz-oEom7:h~Xg}[yLկ(Z3c v}11#i!})xaCPJjgu v3ןUኆ`*X]SJbhkE|Q6\*H>Z-ٳsd2 TI|/g[@l^ε>a{z4 \E a5st ;0'ߩC8ZPib* S]mo޴RқXBƣE뾽mv)lo:nu+\Fc 5 UƞA wZ-&\FC4ig,cI;# ,5WaaTGnqz:F]D'0O0jCcl;*[O1|9P}_ج{qpE̠3g kY&a}۳@kcl\E$zjG7k:}=m]L@MIic4Dd~=nc7Y\LFj:F~Yd!iދY:wiJyl AWFf`DiUAA"PR`hyMο8Z<#I+g&pɠ'TGa%&>vdSx(͛H~c{Fz(龽ݬ*H=wLDu9ݣo]9o1ɃdEH dyeb16Y]hEռ9ETa" FLGzYA0#].Ed!zsyijy !rC_9zXv9jLjF}T#奚)Po|90Vkc~iɅ }E\^αA#6rs-ŝ)3Гs z|lIlmss_SE5M& `76~K!G4RY olƊI,\!5=YaG7FbHFQm+"bU>6G "5zNlL'?ߣPG\kEC2ꞌ㬋b7:>Z$ĸi=yγ`I7KժuU"tPӜd%hQ@zlh8:Biנk,Pi0@گ>[FaoiI}FLoֿ6o>ao|6{:-( M7EEgS}\Ve|V4mE鼟GE"pim@3 :L8r^Ish:sf lg2moEom7:h~XQ!:l{1Ûi饉dfx>,ȥdSx,՞=:ƃ3ؾaN|$: aml"iQu<̦¼:o1ɃdG=C텉Wz z2ADjym@`aoUQ@]hHyC~X{csm9 GIzM0؀;fvW~CZo|&lo?90Val[h<̘wIEm**)Zm# y@VNP،I۠z:bQd$l T}aoYS6_707>shy.+F{ӣ5r "e_#11l PFce֮r4#U5XI \iXwVWF#H|3}676~p?,yűn FiEH!ApQt~L6 ѪBO b#eT-=sF+r`|#Q7yh1Zcqe& *K+EI6K }gY~y_Z8d_cl/åЎb(8E&o `z-S-X 9P_e f]b*E}Qv6>K ~349-R..Xs5YB%MsׯFco[{S4( =v­9ݴueGU"GFTPi?FH5V:cK)Hhyb_[vHo-,M"_j#Xn'GEm>"MޒA-ӁrM)y1ɟf9$)M9$O!P[%MiA7՟8n~GAR̈́7+puPAIG9HE 47mU9͢fURذ~zl>Ay٤v(;zͰ'Kg,cMT:|l;uA@ƪ*+ny@_nwvB+v>>B cicPw1 |3}676~p?,yűr.؂/D7Ҩ<80)j~1GE:a-;1=$n=V2Nq}[yJ48vI †V#궃cb0󲃣GQO;84u cUps+lGzE6b>3=uu37TurLD:RȄ#viK/lEC^bsoZ,[3!:30,ȿՐֺNA,? \z|)>qmъ KwY3M#.;hs T<:V&I9_Hd*H4Gž˼ԲJDlMR樴[zÍf|E9[%wGVcd@67P:HY>KTK*jJ:CQja#ɛ11c襷!U5NPyV`)~w@FBن ̛U$#>7kNr >:V.Z&<}¦)*CTDWMIÜ 9P2TXf>[rW`J9ꉑCFs`F+G7~z5XвP )aN]Y`vFs$?q?oTvJo7ېlvm4۵_0HhNkCM4$IyUh~Wu^IU{kx2A]k *DmO< KG4MʱxmM쎨FWlv` ӮoO^:J[j]\iPޚ E!dg~XC|t1}| b`I/DU?~ćWkc\hlBF\$_>]jYiSB~7- B}UI $PD}+|PrѸٟ0!0$BB$[*DsuQQe;iU5DpS&T*k Eײ̃b]U)u|WM_1vm"Y}S(O/MV {ىj$*H& HPh QUQHUtW詞BDGk!8hlhH~bcױ܊3Tik8VA6YOw=W¬;;d7i:JNUɢu{t fnVa@Re:'ҁ= Z<PC )lmX-?/%i qDSseRNP^Ul^U{nD~,ABqlP"8% %e_8l%4!$ut4kT;Ufj9 GD]l5 :ni+oyĺCUnT9ĒnjDgafh/Š2DUB-@Tx)E:PP}_6!{wlHj_̕Oy4N}6T Űg9r'\9q&dŕpz<**"igw]tŶoqq @HQ5UmWg8|[ &7y\! ĉae^hƝiCmP6QQuOn( $$B3z'e*WRV[U6U-#ٶF)#KTRQʣkDB|+ fۍn6J+jSQor T4 VCݫs$;{X*HAQ7zq|[ϚYa6z :BGqQC]5T?|J|I `) iwOjlˍ j/Cu".JTԨK3";8>mL >/edog2((S>i*'G ނs܈Hۀ8ˣCq<[ؘo,meZM7tT&c/NrN#ru{d+"\v_2i!Ԍuv:DF!eq5"kԝ>O'^c f4ӹ.0Oz'i:*@̇+HHPscBB $@)Me PU&"Ӣ;&?8+CRBl{@7 DZW]IHUDPtTT^Ϥ7twǒ.QVm&EQt_ .K@3Ҳi8t۫WO#p/3]J~D]uKŹݕ5!T<]aA֌HWEOosI-mGYwoi@p7hIuEE/ky`4nQXbW3ഁ!d׶H:Q=.;d4ǒӌ<ڨ"8Ӣ./TN&/ܚ1 ;FM;S$F QtBTm"U62U`$#nWFwNCw"kڜU,e4D_I&WOe4+ & >\]H][خh@8˚"2-aר">Hc $AtYM &#H*!>%BDM֜utUq6ޑPnmH$EO|n'U ,㷕5l@&"('ƯC ew7u`G_z- 'N3[UETUUQmMzǮ1+ |[艱;<^u]4Mp}wX`EE!(SpG#z&މ``c-nq|RE8$p{*_o)LrM\i!7=EwYcV͠s@ ࢮMW*/QxBոJq/JԉEd\d;>+M!:2WdQM9Of#MdAprEuQVbڦ3i9cM$@`b`b$*BEbexU{PW=?e&b6$q8ʆGXu G1$7K"vHTHNV:nqt9_ftY;"h;"A\w۲ؚym2']u|7Cb@n~lCi EE-޶;^IDOQDhDDUEEEꊋqpeLu[$ qDp QQQQ|1I< J]D=ǐZP춪jZT_rpyF .+O*:'dx唚{ʉc2lˈ$H  4ꁚFUj-†&="ljdzbq祄"K7&Si){m"H\B(Z㼍ݦAn$,U5CݽĆ)hr]KҜi"&.,n䡔pJlY}Ey31uEQiT+y_2E]uYg*0MǬ\NkAbԔn!M}xfCEu4h%4%,.\Wu8z9v!R>f$~Jǣ>'9N9ɰpwɌamh|@k)-c56ޢl{o&BǣJa a ET8Aeu_`N~ 9MɹP_Uz]͊LݙEZv]@"G&i_㶝CTM̸o&,$0˭j&ۀ$+?/Zo23)qIJl4t]Bป_y1E`Ѳ NB*0g7`:"(,]ai%.oѩfIdQegE%Ԅ\UPV"sW9~f 10UETR=4$[S8nj{@lT%x\ږOYzJ*{ܝܝM 0 .~*=&{LMDz*j{Si/o)(5bOJQe0J).DʞCu#TW,%kC|%mg8* ?2K,cDlC#-PRL~r~ܢ.;Ij~l>[]WZEmbčݰ㜊[ =iŬNjiV`ةWb DJ&GRi5NH*tGզ zu-EQEvUƛTEBF]ǡJ:U!(YnNXH&7Og~>}$fUo9M%GgMGhOxFw!~_w^t9'1h&[ lx#j3bɯu" ˌ>o2f̺N8ۍ(f / ^mD o1wo׸ Hr6Ue7 VqDN+HEKg5ZJ:Ű&R t'݋2$ ]bLY,oG˂$SI_Wq#oQ'ob+ͬ۹[cV71UqS10I21}"Kק<މ2;2l~<^lB4Q1T%CR#:$\˹%X[2n\qm𫠛Boi6d>ڮ*W?ى"cmƂ"[BlPzk#* 'ˢ>&e#*85n>VͩW`)9rL8byeMƲJ[W9ɨu DhUAbcNHTv1Ry)~Ƴ@'Ds  #$0D$> sN,Z|*;E3 ]5o!Y]&&(Y㶓/ifDz+K.9y (B*A`(7 զtDl[Q9U8aH\[Ɨ&n 49#*ޟe^|-"**'Q^ٌ̑g[>z#ƹ{NCk U+lÎYwg WG[MxMÎ2.ѓndۍ *****j1 Qg5NRv3wDg+4i[l4RuYC*NXWA?lOr.60 7E1^o _%ٮ?U ɸf1l-|’!.~<$qh Q$Eq.˗2bGgn,-H죶><͛O4ࡶN & _78Fe{U~fӭӭ*ͼ@cSѦާrʩ dVY/QTpڧv~&UTݐnm4Db7+pc&7<{#3E&liƊ*EdbRDûKhY:h֖ξch;* Jhƙǣ$)sJDy,4v_ *0u\"XqXHd*!8fK˘ߋ2ԙ`УvйADoUNFe6_?5:mr Y?HcGzLW7b`mo6ܦ_l@[gM|p{n6$@g^nQCLB*b̘!>"y <&$(7d|Qy0YE %Cg& %"3ycTh0a0쩓f>X#0 $|eR#"AMUt6#DnCS DZnHMUqp]yQ{K\4Ƹf iehȷ 4Vt8q^ԅv[ErS?+-/0.**HHqZiADDDI,ˑ3 RLjƮ$G*}J"iEEO99j"W]YN-7*-dSsj<[m^v&Y0eC6+dzS+~KcOrItաRD*$**tTTrv#A`D+񌖺=MW4QƐȎ苌>ڃqI2q6:ȵ8~ zD$D]d"-|}(e6*Ͱ59!Q匧qc:FÁ6y+,%_@>:yx"^ن$ӫ]hMݏ5!|.IYVbt ΀أN'9X5N+d͝LUtG iFU|X=A6IS~uJ,Vdpcy 05穬/팪hn 7qS$mk KZ6$GuePq51^`b3,nr8;"IzGM\oܝE>OɲjYW:z w%OzcG#~zd): uvj|)OECiEz)%Rߋ@q)pe"UcKlCgRo` #%;d%H՞<".[*"*!/s{I}A1 0%8~b ! $I5V%}Qe2ԈcG}"m]lTHUOd=b|̼x2ƨĹNQ#gZb湩8ʫ54uIQeAYM&ޞ޶Kk,6̸3dy@\mQ$EEO:h{TwI1^e0c#-\W{뢳 IUms>­]Tk[(HhYfC Cfӂ&九[+;m_2-GAOtF_AY8ԘMɡ'ШQz*t^!\1XFlzػWbTN8BFfdDJ"DcW"Fz\)U,I*9RZ}訢rog|2NMN6Å_bmRck:,md-۱1_`#?ÑiH VAUx'c3ާހ(nŃ@QxܪtarQtPïTbʁWȄ{ &r7Mziy+L{#Pq\c!,"}͈GER6Oܓ[am&&o#,[:8^oRm]l^h :ћfT ̘~_y 9 ad-!ty1J 7ChUZ@ȱb[bYL(λPƏfK*L/rJEϱЙi9[UWFw*lI230 ܁q t9>3g*p H:#۠*M<ɦӭ4D.6D$AYl潄Q#aj3"o8IYQ0^QrKY-4衶.BTT$@D2!/L]_=zZ"y9l&Lޫۍ+UHS}٪g3>UYyjXܛ'he]S#=>Bn7xδ+ņ-B0' RX9Mr;ް;f/Ue Q 6+qƘѼvbFe{|0i) bfY(8$Z{ضJ[uu/d-c: mёU| <p6foQ]&m&̛#l EQT<q7&V8?a+$ԀWީ< 0f@|GE4D`.ofMH}eiqpe挛u[$6iQ6lI5Oxy#i6hW!bj%f֪87|ɱRQzB qUwe]4҆Lg;@|b-|*{rr=No yrA`\Q\Mqv.GZ0ő$fu[IɱΦ*qԛu[!u#bCfف<Yi[M̜p틘b亡:_b$| O,Qq 夾%q2,#/@c2=I T{xbO*siM dsw8 ~[\K-ڣ'3QP݋!\u`_|6$'ӵ9 &kh3_4J*zX|M|J7bvazӧMW%tXcyl5%P$ Ri6D5N 2~ ;4Dy99ޝQVQMӧ ,pveD *v%ZXH~OU芪=ٗc"8˙p%Fƍ5ح)*"ǐBIW_ec)W3s ڏiENSec\(R𴜉ex=r J'FKalGIE֔!TQ%EEd|qss̮OqL3J:ưiQ+rYD%mMKL:jSfuq,[@}F';Eȅ|TX Sߚ6(E N8fJTHIZ5Ϻm1c,v ˊ[DRa͇%1BO1[œKyqO`MjicO*+ɋ%Fy </dM˭ +?/g!ǢBcd+7̟D-(:fW-ĹSpv;<ƬVb4TYǧ`)x*bKc0qU'DErE/ۑ䴪Ԇy4ݸ4@t*fKmhUUq~dFIH6 SStt{| *" ".s>KțWkZa* RpGJ<۰!#E!&t2&͛!s&Ky2ʒ="L5#2U"%UUU_ôW1<>hY!8/@w @Yزr `ƣ8*K.e[m9# F1W1ܞz4"c\AU&SvJn5,hzuÎԋ |p5RU<,&e5Pn&:HbLGBTz/v] doKqJj/YvkܭM4TlF4qw3@x2!(Nf9(c"腶M}9P'x˅6;eŐ(Ęσo0d"VxYKW5O4EXx~&f@R#<.GnD+ ̖*hENpH;JhF#~0jm~շO{©Eè69fVQ!@rǒqj#60}M) ($T7͙N܎'rL*1=/dxݸ2OT"i Ai7qܲTP>jP[s\ 6-5*1(!W-Ņ |^4&]Ծ" s %lp ̾F4*ޒZ[qZ1$`:NB(J]|i% M`TwiAHA:.-5Mɪ/E_+fK%gtM:U:/TJwu=ۈSzоw LlUzuh ]pm#32TUUUŷr$PVܙQ!2ێG1uYIs$+1^J7W_TiƳP^L2KaWN-!ǶȔӫnŀh4+6.V,q.,1{&QV\i%~x9CzQ4<ڠF7lȡʖO{q$h'-&G3, \OWcLTDrS n"ębˉ)#ɋ&;0胬ˠ`H$XKIm)*= Ʋ"$R=Lw UV|V. -"g\mE諲|?1Ʋ|vفYuEs -;C|T$E|Zh86i;\@H-$ʰy2'X;m71O*T׸{٢!+y5R9AIÅRx& 01Q01UBDQ!TQz1*+FFeb/d.4N " ۹3cE(Xb=4Ћl7rٵb"h|ћ=$Y)F2TDYP4Oz$m׼y I^* 4qST&GwۣS>m lO ǜ'B#f[n" 3R,%I>tN1eL2SRF2233%#%UUU_j<(Qߗ2[E+NH*L#a7^}MQHQW70b%Telɪyukv-cCM~iy{QEDQ4DDNo\rî9G.zw_#W:lDR"y|2r*USEze'&Y_\b50$"Zc4Udu?ZQ|q0`sF1x`^@fhÚ {*(UĖЅS9kLK%|s g{&~K[l#3.E_F]NN1-eEqh]j(bHD哋9H`XlUOΖQҟf>^Hn/ WgC~d6Ǣ3Uۡhiwk[pz媍|7Gn\r, ~Fҙ UY~f`frYCPy˱7Dm,E̒24M-a[}b\M <ޯ|/DA/BT|1EߝN\㌈~->`UZ *d I l"mPHSˑ$& عvԗ\ȇ"ڑ쏉rCW!hEa*ycW[pm?Q8J܉BHOh{:(c9ioR+Ii"J3Qa=r yӿ5eLE%M{dD-3.*~O"HnDWݎeͼÄӠLUqXSޖ/2{TEݜQ_SS _$ETj4F DU:x9^d1rBu\hPn"wfjMY 됧Cjap'bH0Q(xЅeedH# C !$Hiјl@QQkMܓXDz4eq\cYV gEW#xO>ٶ?Wara7x7PfMEQGݻcQdW5鯁0$!$BBMPSTTT^@9McW8Տj=EH?tD'֕T\TTTEa]c6ѻ*+[WܣO>(ͤqq#,~T]T$[r}`a=L۵W$!53tR)8k[R8zW<%+Em~b.sArZe hN<%tā&șmQ.ǃ)MpN+.Kqc7~Gㄨ 6d"Q|[\%̬d. 8mhhwUAU~r_ q~O²*u_ݜ4" 5 QI "*rq~O,l$(膍1o.q#Wb>E6\OƈLUQQ|C0N|?&Ylbϱ⩿eKWl/w4rR$}Tc$`ӡB9}|³dkr+93]c@p2QG{īKxjp&D؞u5mO1s\E]$ SݿtEM4㮸B * *G#+s0pU^8V8G[D-amlRA1SOj[]NXVԦ e$l/D8U1Mü抢 Ls頌|gԆ6447Ye-h14rȴvDQU˞}/L?ln0uF<|Ekz~F~?"EeĹxbQfAQP* Sr ˊ&=)cUfRxwl ,qʮK-5-{=tEnٌ"&+g!T'P=Sl 0.ApN.6**J/0$ 1CHIDSί2\ dsKcnS `Nzv.34nc⓭>.˒Xd#+Ǫ$WNd~7亩3^urҾ^2zU6Y:OiPTVkDzw-ɘ))y*.p) d%ڮ+Q<3"0{Ibj*_ iO0n2.O2ndn6h**hUwok:kVGήȏjC"IVwZ'ErLpzR^"(" QSRWY͆M!=W(HJ/58y[5 2OE%_|*=ƟʯmY6f(Қ+xS/4_@Y'}U8E6J?_Zjn]ijOƆ])\r/<;'8"c*-AoGEx%iX4p[ do'cN|m+sE:h~y}K6.|TrYDJgCL[7$ pUDQ~^ JDYf5iƺ4n [`WEU$_>8l(N?ϠV,Ą X$q2Oikj(]Qw8?F6s uIۨr &ʚܩUN릉|""WGr^$ zt@Q9ˊrhW; 78ĈlnTq!TTUEoj)q/!@ LOu6V%4E$Q_>5ʁd "h*qbM:{QEUmӫu5A[Rw* $&ߧڴ;)X|h "}W|ȄJ*ڴ$B/Q\1H[MmJќnm14BeYΚhD}ػ-_YRX;-ac{$4sMMSŵOS8~Й])rD{ۚ ̒&!0%BQ!!]PSEEEǸ1±\MҶc@`a@^4*_)Pdy 2衊 f.ʦRi*|)GHr3ɱG^I/'o;f_ZUŜE~%_~imndvwv+v]SOb VD8Ϯ7j Mu/NeFb0H[qwͫ Ȉ*"j.d5 68NZĮlY#" |M4@-b m ""&v}Rm 13;/&d,?)S̈MGtR믟׉%LMu`߲Xuj*8mlS˚hFVuAk {\Q:/N93 (2 3, 4t_"D 1Q!_q ""EG̛-TZ/Қ0zuTV=~M~Cp3ADb5L"FUMW> Z6_2rKoÉ̘M GM>%MTS}4 >ũ/ِhco>R!M\ohdwb3_B4#"h~ahsd*FJOȧΐ?$Q ADMڷPEUQB+5UЊB*};,>ӢtIIRuUD̀@DOQd'.fm8Ddo![E%U@i"tOgo.-\FeJfC"iE>zΨ HYV#i496c]DDO?J"x^d@MJBMU B&*/>eAw@C ZlEWUERՈù~z{n7()=DQ>zV7SC9Y4Pݵ@{mKA/r.wݯUKc[jS.0RD(}@rȏ".Ɉ8 $T|=Eς7\*^/o;?GGs/;rctvdވE2Rdϧwsq*$g%kLSZ'U>z,[H8\ (m5]UU|'!XfM [yhɉ|J$Ɍ8{BETT_?P/$BT=nMbӵS]l (L%ωUuvCK"M+TTT5EרpI:}(IzI E:;$;%qWk27DQMI<"❾%<}gGU# $XDv &ncP੡Y qX6M:\"$Gcq>Z[ }\M[*̕^åTMU<Y ~+-IGESE|Ț*ږMza Nj^yěa%J(+" vZBU}JQj'9#W6'oL.ǎ:feJhpUM~+( sCJmL_ư ^!ܡ]T"q TQ?"2ěj|_ DIPk@"+jUu;±o_с6Fj *.\IWED]ީz&/.&R%swcQQ4~!TCt0^ćQuRf9'O: /ɘK82)Uiyi]qZpTim%BEEE|rg@|&ƣ۷ɯr)FՅp4 qxI(YlJܕ4o[{tMQF=ψhUU p91 ! ܑaܢ/9ԯ*@MDe*UL_Uj'Mw.\(mV.ӆB̬!6ȑv?S4T$C[2kW&I>Bs*|)$*/]Q22 VQϵcvys'in7 lU:KԓUԽ19H`yƆdsL=*f9UXŲ$E([)GS*,BƤB,#HPc1ڋ/UU|zL)uv15@Mw0nĚ"*Y%;Owaq-a1|Yd+#Ye.0骫Q25N{{SԘT؇]Wmܛ ֊}By-"dKOetO, enp IJ,w4KB 1 4M|y7Mp~Dj>s}ZԀ[,Tw)9Z "W/59+18IWM'< vhH褞XgL<13[Ȼ.!U2]3*z"8kx;P;4x ~ہ^i駔n4Hqޕ*CO>%_",q]ͳ\&s]F6DEkp: ALK!iCVZh*ExD'$%g{6m'#j]~:Q\O쓎~c6[.26Us\a\R=ABN1㼕f .1Q$itӟhq%vQOmt_gi#NKG-Gx3iK9d[Dq]6+W 8ft1\T[4K*4&L'¨uxG5.Gk Kh3"ܰo䴢=^Hyq?7EA74Mp  K]9AuPvr2[x:>۝c:=QFEuT3Qw"FUN|g̉晶;A0LV=\(q1IAG%ӯaeYhi@m@4O+7WA5WMB+>IT <=!Su\y_y8驙/R%_!#2@ԈQQWVƒbm?¦@U]~Җ7CʵKd1bZdtU'\kU_fӎ[;rLûHsFksju>L]b*RIS6gUab7r*eX@%pllZވh6Z*S˓=E\Wn8 f|}6Q\pGYŵO iĮdDD,WE*|g΃%sahؓ\gI2 bH$ٯ*ڦtK:(/m}ە l9-TI- *rފ!cCv;Llȡw#j.Rk.2"llЌ/._j<\Q~Jr"bX'\8ɨq f{YKiZ"reԼqcJTqn0CVӪkj dNDDH-DO.U"Wb \w*kޞDT#Vζh;Ӌb9F :BllvREE4]ID!a!SN;L(m1I?ww:-@aU:wpiz/G?!geKX" guL FݖY3*Q&0_8͸LyJ"lu* }Q.yZYueEN:˂@b&$), ~kNgʬ ,6yQ`T$8L̂Lw^'oxG*W(BO0F8mي "**hXFY]N7K5Emw>=m{;.H .0;J' ̈́4ɩ)Hl8dDq=HD-uE,5M:&̉hJ>8//ȶwTnLJzHb޿Jlf|SnLśk ,1KO1$c w>\%*(AP݄͢S r2LZƂJ"=ҪS%P4mWiB5ܥlcg|qtEf-'&Y Y*bd&"``H@`H$$BHEOޞnS$\+{C3*c㈊U*2\lfLg";CO0F4.N ⣎}Meaڃ[ʭ9}I6-"䜺T,lU!D5YnS7FmM$,+g%QSbTs6ԛpH PpH Q>|8~>8$'ϮI*y d2ɭMFsH<+*|"qui(JE]5DDR5ʋ\1rHHi - qr@)8sp#>ʖ?UD{M,r֕*L>bʵҜ gYyc)~3d˴.MqMk+13 ~Q߬#>q}-IOdr b}KWqW.]|9-z;ZG[4O;{$Ȏj:zDny:ɬ5I !&nԽȈ$ò4(D>#4,=l>oNV&_ 6Q >38-vn8shOTUV}q5c8F-@rbjI#: BUp7Nm{v Rq}tl!($2do̙VS%XXJ:|6tnLR_p UUU|>nFMǗȑ_!,f[cɰyVO; d|k}!:cAi]YQv Hn;n oyZgbsLoƗH~@W&f4b/<K>)nYILqjlc&!"5!3<Ȑ^\:k->S2h /E)_J8a2yn{PD7G禡Ŋ*Tgi }kĶSoW= ʲ;'AÈiQ 1TЄ=~CKܩm$UmEs  v-Q$!T!$EEEEEEMQQS ^!Yr dmG]q-31jE#҅I9]]XM*Sl,l&rfN2I"TR#q"32UUU_f&n1܊cVVMeujT)jDwUMDTUE$y;v_Wej-6AT-Oے;Uu'˓ړKV]r?'-6 m&6c##Bmuwc6%O ]"vD7pH̕Uu_:|,H|);:GVlhNPQ92K.SE6:}D. QAi']plUW-n܇c1 MZc]XQ~^0|t6˾p]UO#UᮽAb:y]_.,)ɛ`eqYt+nb(&%~f#6dgGQb'?q/Bm*-:ܘ:âZ&'Mޠϻ&R=n-?cy[b-eLo0?PG&ׇ<65u(U7ch^:=\I,8*.n&KG!XeWy\QmlTQUq>n[YMܚ:y5G!Bmˍ4UXZnP8nN:8dDw\V3A$|~QHi [Qϲ|[$ V%߳|Ul2--6M$  ,Á_'"dٳ$qċq!R%DE_8_w-dR:&׼'{6荿ӭG0J^U9}9Nr)dW+2 Vx>FLȘÈ=tЄ͵S0ٙ  ۳OӺDZ/Ly5|x5VLy:/Vbd<4 -`Mh-ؠ6@"}7س0 b6qɪ#F雐5a =VNUqQgv5P8`͈E"*/;oui9ƙrW%YW3%7@J%^Jj.yodY#@^csYf--]!4R1!iWbIJ *'6liLj +1v7\XFw/7p,j< 1dM{OVHiWgRLp}wJYYYY3WMU F8@80zDHf $+'u+q'.bHKabIۣ}Kk34٠9= >;-3Ƕ- < ܏sEjMh엷Abh)673Y>'Ν lSd $\ח $^ňƓ;8h Cy/ϖ˛ݕ~)Eg*I(;LC}:֩'m$_z}+>gKyH3Qȣ,:c[9Ki3Ĉ,S+lʯ" l6%Cmң>*{uWvUTJ)E^-"X@A~,݌/ԤhĽr&&a% jjpA Tbumd'XBػd)\v4$ q 1TTUOϰ L;*dُ$H2_ elTȐDSU]1D)z,NB9vU@aSle1 (&dK%ƣaMH̐Q=]/嘲Fʎ55+X.R=[!Ty:O|>uQQx9tk"ۊ> J~VA1/=$vv8e7o F 4f,a06ljxO2UD__(W0U̳f[-=a-ȯ8hl]m{` 1sNl܁wꜰ mњ~!ee_qaFEuDwdϞu GI3SǸ$G*noYVsQuθ =xMq1O4f[5'bV–tʲ tp+B1`p1; 1|zu- $&kaDDԕUUWDOzw{U6&104K$jH^i'%:AVa嬀a8Bp=pg8Gg8WTpi3bƦ8jnڈn b X+P{:{FRq qA#Hda !T_VKʨ,gc6/|)ݳŭ[ؽ6F7UPI5_+9c۴;,'ƾb¯ ]IZ[D]+02TLs:70{QJDU]QQ}[yYyu ZpEETT]S 46`*Ffd ('mŌE `qvRD c=PUT"(MUGYu V )|靲$q;8ARrS{74H*yg2L0F9-b\M6j+=dGꒋ/\~}V5{ R__QEǛo<Sx"%"*'$YQzj[Yq0ܶ /rS،\\]!D D}fa3&=ׂ'RRqMEU#6r +.ZYͳ1[jchH(P\s'_kv}Η.^z*O_6"l%dSu[iOpVG&)D)-UUQ zb)}Jl;rC O:jn %UeTZ{knuTXX2'[`$#FIT]MM":blו3-zɭaӼH2Vh).^a׮e 6Eb,DAĐ@;6*UU[c>jYؘAnmG[Kݨ@7UC!fN߫_c]~tEД=T=>ȖfB/Ė dGCQMS^ZN'M_{YE5aQ1,' +(^ZttWiEM.JL4iސ/kY-"RIXlu릿bAR"TDDEUUU:ݻ~51i!繬c@$*I ,-,T2" 1Kac]dU7 Tٷ2Kz zmյcggc1bA#&:bm*"**֗!jN%&w8$4Qr+F,ɋSɏܦyqRtG3|}d מy@m#q QUWD<͔,'^LlcTaW` ԐAO٥9v"dA JGdL1+.Ȑ4 N:]UWw7e/`zH8*j9F]:iU1a*ǮC7CtuEH18*E~b VO^86wPٝ]:1ǣ$;pP1pDD-sKH(92_Z*US]l 9f MyYaMqW)6u6YWMj܈smQ%0ਛnhqV!& Wf.#1t㸿ug-q"F3lHaҳ/U娪ԦKB8147.<2̖ Gl"bh?-rٗ9GYC`ϳz<FΘ6-8 ,=/Y#vͤ~q˃A;WV \4)Ԧ9aKNss7D&rH,C#: ba8b 2Dk&'DO!c .j0Ǫ\eX녤ц^FiDb3)ZFTq'_O} 6QdƯ c"7):ZQ$Q!UEEEEEEQQz`9gat^5P&j:H|r2*,ԵY+YNT83+Y@ !=TP0#"%]49PFQQ_qj|XIPE5%U^ܧ9}6 dw PDQDQDE4AM:'إ[?|tU-\-{MT]:*|׎D&Kƺ-'`XuX0IK *q4%/ ĉOM=t۪JM1dܻHB jDjzw87GM (f!UjK*-_!~a6.W[:t$?*F7IoZVRV̵yQ Z\ARMt_ߍ9.d\(#nD!'HuNyr+e#*2;2̝oHiDEеTQ/{ r&b_dNYMqMTa,f}++uQёuq;#xaw:1K/:( "؎]r7W9szz?ijj E UcAJ!W5[r6(8j<`Bɢ|Eb$V2^n'&b1%`Ra2;nMĮ!HaʘL_FKz,UQ"PËJxpmu&8=J:n"ꩦ<%VxZmҷ7lTX UcɜȔy7EWRܛQ;mE5"K-’MmH܁^nZ/gA(5) MJ0)**J_:L3 nr̷%Sxt{9g<M=*\K *"E_OV9+/wĸxsn36ĀG圍\cq: )f[?cZD6# *F-@纝ts]E_4RꂨF.Ws;f(PtzDِjj OquBO&*rG!2zQE#NÁS-ln3 v=s -:Lh_0CWq]w3^״$s3n*+@qːb匭Kw{5\-TEc3+EzjJ()3fN~*khuTm@S"'=1 zJs\ѦNR[ihAAMDE'i]ฅ3s;Ur=csq*t6:&n;m~\EVQ>D"" *%WVCUf D%V㵮]LE3U^ѧv Ey on+0|(͒cdz)j6M׈'lr1N]GF˴}Rj3$GyG2z@BqWܗxyPzK.A).*>;%2DtԒeoMSH96nظM;fH_颇|,>gOXϷƘ-P'AÂfA\ꖒ'>-Q̔HHuR%]UUUz ]rfFjTH5m6E4cؽi QRP*'R"#l'Xr7YFz Vc+b^W-SW< U![QW,l%%Fu%U]UU~&HE78u"% 4 :5RUs|ZI[Z+̝ٮz"y5;N>L넀mfdKK6̎{(+#9 D@O*+MSRπK> |}rcLDUY[HqBՎ |}eĜ\a=\GJWg96󦈣ǏЅTIrx Q3sZi]8~$d68f8 TKEFnٶP\p+ }o܇7TQDQU&G=%fld;rb;yx (B8~?xd/0RCx. gD2bF?ɶn"Ӧ$ȵGe~wHj֜G:mB-M~n]|+/ QvC%Y:"(\-ύʐB*-*(&*(d"J>)c8""JT]Kk:~S]/5q/,K/vFwlF|B!ވ;cxOs^bj0Z*qxUUPlM5]uI1|8#i1l*ȣ~Sw;#_ K r_UMS㇪84QHUb݊ .yq:FJ_fyFE^H\VW?.cc_lap YXHX۠w,ݞs|v4̶CR@Wɪi.ȇʖvj7;;Tf viTUa3@Bhj+]Cb|oU3} 4I[UA\;z;,jJY[UU=}m|(lj Fً+ 6؈gY֏ny1^ ˜Ft|kQٹ )|خ${SDAO$E"%DDDUUU]6HꨎV$eJ$_꿔OM+F>QY^XcxɉUѤA 7yZoE$y4N>0o'c3lg>)kÝ}njw,jxյ0&Xq_]e:F}WhO\=+UyҷpPv%$ X{%Esyۜ8Ê+]X]u)eM($.D&uivgfEVY\HU8CXTD-}%Fq^++6+T&/IӉy'ݎ@z^'Qw4ދEGOv]ķ&K{M 7ADUWUUUm7]tŶlHq$mR32TDDMU|3dm6 U(Bw,zQkU.f[ܱׅtT~'lJ"B%'cd}} ADWۊ:*߃7qa%\'l83zB1*6Cqc1"_z*tqǨl77[@㧉D#RЇRUSwզ"+ q~C+#- Og) `@=I@IiM94bqeag]1oEdƸQrB.-H}Qu$MXN;w_,o}뷵b87¶hPfG7!B!٨-̊jSE l,Oj҂Zs/ R oj!w"/O|º%*TQu~nCm{D1܂Xw(MgPUơ|^C {ɤETuU=aWڮxbe{_Byz4HK tDČ}@g$W#A09((.qt(Ml.0MY](;cș>ol 9dU>$f@IQSD(^2m'\_ l-LU`) A33$R#2%AMUW'&e$H6'P8\}y']uU#q H̗UUUU_8 Gv\N 1*n:{Q=Ȉ(FnMTrVD>Tu0#H˘~J$tT7juԕ!1rײ.v/yuMQѱe4R '\]BfFUM; +z7qǞtu'pu#35R2%]UUu_a?.S捳3F3U iŽ+?I-=K㊢`b8㱘њl}5%]U}ꫪU:脽ْ5Qt}zꪫ<8Y7GQG r*jwjA$~ȫ9, (le-TBy=DEUU:UԻt,~-ҚU -Зsk '4m TzR"i*" Jr%EVMd9 bhpq4]vi]PH4MY`m Oc*1_r}G\Y_!,D_Lz/com_\:n)\4SFh몺{WS3^NM4!"`U1jI9 ?iJ.|gHvK;DDUU]>_ ɚPV!$,zAEEEEuZEU|68I6ml$KCJ00]t툞{Rc;TWG&6YeOG|Etp$'R^i M?DdtћhO~,.q7Y7.ؒ_:eYl`J=5ܵi{~/l~ vn䏋U+j:}>"PE]n|GDTQ7"* N>uBi_*? /"((BH颠M*aRzLU'U_rxLXZIt}J۞$~Њ(Pzj%)\ʢoḦO _2%? D ȯ'FCFҺ8$HyCWQ).2>ӦF"&EWY0lcOqIhW^Q$Q!UEEEEEEQQz,Ea/3ybF_OINlq mhOOs ,/Ѕ*BHu_F_ &: *vLH%$#?rڒyiޑ$i'(?Y8HLt%MFCZj-E?W#~<I-twcGྲ2Ta]4]Qt"DJ"(DJ""'UU_ ́T׺5E~6 ÁV%d/ҡ'8| dob]:Og=h"h_Ozv>Zr{K!"Vr_}:g==6'w|i $M"Db2itі4W/:Ҫ=p(mP J|It#4q3Sx+3 y#E=s0l>/Fa@-`6 "\B[ Hȯhˌ_? kk`%ǔp'qJЍEQ$lquP%B*a7 qSd4-#=ƎOF̄{6:*r$rIwp+)_1! qAhHaiP5Oq5VMxHw1xCNDŽvr$&UN0ˬ0^rCCDz#cD5i2}ЕobՏej#صD(׉s@&֔-k"=0q討ǎe-IJ¸|J2@VBo %|Hm 2JlJr a*M_ <ȅ$OilE%uA)̢ 'Ī?hY Uvr8!PߘKoDVr ,*)o-5PIreG; TOqw'reH obVu:;OGqe2#.jBxwm7?ܝlбJʲjg[+|DTQywU}Ȟ|x,.8{Ŀ3~r/ W&rdp{K֐EuTU_on?ѼAMwccrPSkhߕ6tN5$H8B.8e~#yx+M~T비":/;"D\~D7^}M\uqI]uR"%U%]Wqs~*,1I'ާѩVEN7)6Kmpp>iNvZ#0oLJp'^`h OԧWyM@οˢ3Oq2>3\}>hb;~q91{W5C9 EIi>[M86SؕS:tsId *_8_;KuP"Y=ca@D՘#pTA>?.[ŋdI!fm ***}_Rf#f,{kX-[-L$=5K48If ޙ6l. 1ĉ~L4#%DDU_k.J3.GLTr&StIvL횡QA:bDʺMqLY7."|RI"{m òǙ33!KhɧES,Vx_4x6.̱?([MPyՒʈJzKq9'3iH-#D'nf9jl]q q?:,멩G$J1bEd tbD򼥪̧ad &%[h/c8q>L-DRO'^?@xdyY,NdUg%ju*rdcE}Y_uKoE}E8P%6LɅ: ݍ.,D1!!]<]78Tf`ڽ:+q o~E\laT"r|fd>ثgN ڇ[YW"xjc'+k2FC11"~7sBEQYMF7ATISS_Ua="FiQ7jxOw|yI8xª٠]@ud8c>)9:S%R#JMɣ<ڍt /_ P)4j4FhcV?nz骪D nqt+G"6ӱtՃRnD4$DO y܏iauq ZoD]&+L9itU_]asNqlj]q bKd_UU75Zu.|qɚ V{{hĘ _`#h J~ywߤ /9?~3/߼CumlyL[i7uQlTU5_i(n's]eʮ=Xh"JmA;vYY8َl}gq>Z#Vv$!dWT;+g`=U:R:kg[^[ <oDSa *&\s3y $$GzA*Q!Q$訩?7ڲ*JLò^TUz9BDTVl܋,h>s^ ;k^j'%ՒyM4~4m۸5ސ"fye>J市?/QzcVPa.*~"4J6e4)oAMߨ Θ`c18p;-͖Dr|D5ZLv9ԉ A-I'Uo⭶m8%R4K]⺒%QϨV7 evT!Q]ѧƨTQz៬l{಩vsS::B./|9d!eŖ/L~vQ>YFⱒв"-h)ԍ]6S۰k/(,beUEJsf[}/'^_Onf[YeOZhq9.JFi K%mO `wܙ5쳓dO(˅ سrXK6j%OЕߨ3#9>U1h""/l]եEME|weKU]%{rvig|!`~9G(8F9ܛZIQSO:<#E+#qEp0vv9]ݸ&^: &s `ɸe4Dm.!yD]< &P 68vQN&5dK GՕᢣn&p-\m̂TIXlTxwKWεrDzD>k>..>~``Uj.`A q7~Ŝ˜uU]4G"cj$^+)kȝ>| DFS&J|b4X6FB.cYrVn@Q)"zD m$(h.o*T&LM$aIZ0u@\iM1BQ01TTT][{Č3oj"f@ؙ fJ8vSaV`!B;ٲհr\Po-R"@}Fsg p")4Eӻ2"`be[wQv4uSaHX= 0$Bn}2=µ:W :Wo6!$YTFXU8&o:9暛'go[qfc7"Sff&6vEi>|KIOMȗ6loH!R3%UU_QzhÓٻ2Gԝ,\%f m-Sz2 Fƒ/'O!NVn~ZGĥ)u/z]f2k8W$^>GAE-P4TUTC0Zư)}G ^mƌީܐ|e\"C[Vqz)Rubz#pjONiHJrǜ4m"]5-y ((*(jQ|FI|ijWw|Ի#8̃UUv|)" {mK_kvlr<ܩkDED_D=I0KӑqE_2MfVQě1EG"F==cޡօL4[8b6R 5mm粠(ֈ\1Yd)ؑuM(FXdaVLΦlyk&2zt9k:s}\:ԑ!TWMQU4_:.ascLqݱw#FpA5D@2ꢉSئ g_|A~|$l=axrܡeE9Lհ01{)**ꪽU|NE@H2οŕ bA˕v]Dʣ,W6bhͿ7j7#a5?k룈.qW)*,F ]yt9)1Σ""Ҿ!WZKjutǢc. x^X,9'Ym:,r#f[XySf_FAL]{ZqIJ'k82^`LPm%i h\HK>BbFfB*FfJ""DJ"'U_˴3j-bU@ņ˽LIdΎCBX${eō]s% 04s7rיoaMuT[2k0*aMd\EyU0PdVIr$خRViQU@BTT_o=TVۚM,: L,Sj3j"xᵮ[e}H =:{f8㊫z6 NTq.io4/af0ɉ Q]n8LRQs{U-JigCGTwlĀK.,{lD\qEDVܹ$tݐ0@?חG;jN*Y39$ C!g#",V>"HI%MΓ. /Lm]DrgFp1LDdaMWŢ8\Tk%h)0\4|EUʱ~FnGӌH!պ ۬Әq6NJ$$Ȭ1׶1IRM=$=a&_d-yn-u7I^Қc|qZ@U]yVj EUW;5J[*  rkA$ED^˒1n)`.#M]81*j+*!:kW8A^ݛʎ v֒/+BG%9SBqC|IQHU1CWx^@̬UdhofK`.RsQ=|va\DvFZ.1Qi%Un=6J2t~wgwؾ'B; GU b$xŦh `8=Z;).CGhWwvHoqNO{<ۇDx)0a 6-+c;Q [Aոˢm4ӧ!qd|ų]J^E&f "]Q6u]{XĔ#o^XPq\"*dW{c+$6LX((|]3mАGuJ۵ܞ/Rc]~7:._=v_ GE։\T$W+&:"(ܺi DyeO+._Y| LK\C%e3ùRqI;$l0gΏ-8txh? A`??ZqB3G:<P 0gΏ-8txh?Se1>{qlj"z v!ۈq'ۉ3[`bB$+`{#[ռPdMD?S_,a<6Uy SfGط_A&hRN x17Mi!GY*(092KC,HZBp삡C&M|tMilWOe -nDz; З=84(vkwŲH̲Vݰ+xTKDͷV_b6ض3["f$QS2^Κm4NmMO"8еT Uʌ2VŻ Y,DBT @Cϊ"lRoo2uTMW<[i>`O1?bE/g;/eyx/$8Ų$ٽeEBQ)$EB%MUw_mUaIe[%f=ce2 oj݉"iy]sl6qn%3UW"<&#좙") )bb̐Q=ꪉ䨑.d`٫m^!7FDAw~nS*nJ"$ܪESOUwEgZMNԘrHQ|1luNJ ]neTecOu:v]Mï|v(-#1~+y_&J*Hƺ;x']Trm%˭]q7 M{b1hE# JZ6jFDK?GMQ1Qǐ3EPY@l9")uUԕʃ0q<3_!8Ⳏ[Iwq]ZEbfyWZlk,ưRO5d9,", *"/M o54!TV}ʢ{cx湇khQ;7^c4 .9M7M rDDUEEEꊋF2?m73Y,Eo% $7):[a,>D2'A毡g/pAo>-&@j =r io."A&Qlį".tbFitEuͶE_Og8`N.w)q{4oDV"Rpj$dQWR!I&zn]7Gyip+dOOȞ,3NEʮ̵qy1ɒU36FTb |epq󯺥SoS6-]lXWXBx$ÝdcnDYqd6&ۀB`b CQ)#Aϱe)dхHb%(dF/ٸo+(#p>A)InlC$ɩz3M{>x6i֌uQ00$BEEEMQ|)f7:E=W2&H7Ĝw㩐qe1#e9yF^ Q)"1u\u Ir3:D!T!$EEEEEEMQQS>G\o(`ܘs.KI~vl]ȻTf"q%4GŘRymjѠR2 1~y̪Gx`M>*/F!NnE@r{- [UWԧWyM@οˢ3Oq2<|#&쾂Q_tuc-vSqPbOC;fqŻ̑T+g y7Retj_Y8E>ֲ3c`\磲 c5Ao_Ӡm:ѓn8ۀJ&@`H/VedVئQI!$rhb6]jN!4dbB_z}`aFўbq!a. 5m=]!7Pew>5A4I{g)t OKEQRDUDSMIA^-S+Y~оxqmus ^2&֥<6m $7BmGU.wb"zas~i͊h;T>eg@Y'9arm[qI[vSm6o̯{Uˍ\2tJd<^ɫgu=%';Ѻe^c+ ͨ_fQX5%f7 챦.eTT EEumlyL[i7uQlTU5_xήNOiuA15oq;&GuߐFڴUQē37'wtb=e*j7#t:x8g4-yl9yQWcDDDU_8h܋1ta=[V!becH 4U.}Ep<2ܑg|}M$JuzVqְ.9!Ȕ!;~lWaleM6( a ADDDDM9ea:t`8*U|V[I'#Nm2 &xb}Z9@A0&F5}N(+[EUF$̚e52W7^sNO=ete$ryΊ9"O1)j['+r@r#a2LbMҴ+mVۢ&Oz(W5MFI5cs$æ}X9P8 ǒrWb\JT%Ń128jBNPQUKG[ Cm]dVW"1a`l'O1?bE/g;/e{;VG1qdj0:Á&WErXN=ifӠm:ѓn8ۀJ&@`H/:ћNbND6"X<%WZFաf,l#b+ | ؈計5?A94flT6kDaquԅv̙!roɕ%!IMǟ}7uUR"UUU}lsxFT$L%?TgJ)Vȳ`b#E{4`TS\SPaS\W$$E#-Z [a%wUjFhK>UBvD#ǹ'R>"EǮS~AmW"(m͜L681u]*)RbKE7Nḑ}FA1/$KCrt鎿J.k`館|wǫ >soN Qzr?&rwW:t,/5#'KD *'DD1_{:&FrȬq_]CR- Fu+r+ աԔͮVm\htm9yR{6ս=~SN)z &j{=ww;`9eud!k 6Sئ g_|A~9<(8 gE{oAna DR!bȕ\nVSomUd,,¾tGMPBRbK8ۂ&NYɸ 2lTPNڢQ#Rͽ1@YSQS -m]]lVaWWd#C`nK:PE|bLY,8@f$-[=<܋ qd\] =/lə&<lI ),si6hɷZpHm%D 0$TTTګqZ[L"}=,Vs^] Fݑ!WAUz" ב.ML|;bK0HTC:=\ k9)eÇ mu^sʦ6ڰ i0܄;\UMQS_f +L[$zє~OomM1CmQuD\lI,5gS&ol\`i%L3E#>6۟`ű:KL#}=,)6S^׷88|"" ºfaKư Vp'ejܩm8Ԁyhi9g v3&FGZܷS"q "۰<]Œd7ˉk: ##3:jv( x"Uoe,tdrZ+ H7n:6* 9[$MP=!Îr]#EӏȐ,0Л !ʍxGrbqC0z%eG%Q !xğe饴H9O+Y!:#/L@\i T("""tDDcŒ#p"Wnr9rl nhJQmI"34D'Ts=5ͪ L~ֱ~WшXgx(}EDٳx'bC$ʗ*O,Ǎ;"o?!QHQWk/;k/;k/;=uE%登قӳbNY26'[t_Ϛ)pWq5ẍ́$ؗd-LTW*xsvExsvEx0q6_&ՑCX6IUQەtN9iTrqјCS^4(~eABUYSt9i n^ ;lp[H$`(ܻ|JQibmm9,!ʇ-Guv""*UW'q>-c27Qg1*ٖ.b[iTAUED9rT^e7*$);`ԴdpQEDDD舉 4/`/{BG(.GTNR4#86ĩii(+bX1&rYAFѓz*#6KT>\aѵ.UmG Ʊ!DWEˠn @ay!:n B֩k &<4Zp^4mM;VDM}qDCUy?ey"xTNUtY1ȅIXj,##=t%E8u&孳֮3;V|x0&J-{# n_N{F+!y% x]ImtMBCWTMheC31$ )ڂ_jD)ؗ[ŗSMȍ*4ɧa6aDDUŞ_,OK͎]l̴iuN' -\Eet jaە_g<2[Snkxy!E7lpWU(F2!.>KG5 X[Z\MUGziz~4*dڂ17,›h H .>M4bm?fP]] 궢H"M>ʨlWaY岫I _!|:ltѻ< ^[bH4D'"D5=_}aמtŶiSq\5mUHQU%8Jpon+g=U=M՜l&+o$Θ2mm]4E-bŊ˲$ɐ3k8L"d2 ɵrd~ڿ {Q#Ű>qzJw.Mf~BYRdÃUUzxI-z |V̕_c_*<v$3b:řSF}6TTTWzHF9_N0" әv,F7k1X hdUC!qP[YVdQw v(j]=< !"(* "ꊝ<;6lJl+If$fWDW_|iU%.O̘d1&d$?7cE`TNmERDTώo{8e5'CqȵUp$}?8σ'k$1An6 *.`5椩RM> @,}~cK-݀B_om-AT]EDYθtFm$Xy{T^4`ݮIمOX;[T{!~zx}EUsƶDojkbܛ84jLGMXÒ0w0+EhxDHUuUurW-|s<%g#nO{i}.4DǾVS-~g&jlب*%iXcAdbfT`R%]&X1y(\?5aUաM6"QU <^GlpO`Q\SFyw !E6#04d } p^ βxUhc"2b)weRר7X&ۮa|v*)iHQ"dzGG$E :dڀٹ>b67K"AyUDS/N?n _cuߥ?-pǩSI%=v+y1pda>f/ɨ_|U/)Gc?iN:ӠMӂ&ۍ({)"d;Ss}Ρ ӻ% ~144U_ |ǧ0ogcٻa6ݷj;{ꊗc;efRɔ]PPk_x'1b.*USpT]t%7~:˖oegb; S۝L GcIti4)6i# _旇RdvxGo+zXUQW]4Wy+†T[]KcoZVtDQE1Wo]M^1Utх])m`T䒤8tB/u}سzr5mߎ&$(B#3EeWlf:7-YV`Edˌ]j,IapCȪ_>S-~qq-obNd5QQ5GQٍ:j1aTfU{J˛\yhF` GQd^}A1V2hG| TE0XWQH/ \ӸY.^z3T3b_c} VII-GaYs ַ!}w6hQ}Fsb8Oȭ!VD ̆gm]cM+n.bQY!IQٶwZ(߆ k' c6* Nf)5U]=nx.n=IATO.l ~x#,̩LTuNgmZ5TLk 745$5.;.*~.>-< hI}+/ؤ^hɰRl^e@߸Fw&\Mub70dBnU|ˆɌc(~͹kV{^m8nRՀe"wmQTDY1DuUSWϏ"\ KŇYrbPʵ/yƙBGrY<;VrsxbmOk`7)|ET=][yr>"\bG+YR\َk_t#mI[jvQc[.L 26%C *$\D6_d$Hwgg,[pL Fx~aw4nf= 6Mh(쿍V\똦E+@nPnoNu{j CDe>d9O.zURE cK %P侂󮞤 ɮq,B|֑TUI Q:ˈm:? O|oQʬc& n1y#km5-ݬ:[+\"T =!T!$EEEEEEMQQSՉdl8xLdK tźfEGQmwkE2㘗ưxJ>++h)~X\cUOn_mTr+HMce^#6wS'OiϣWr]IQ31aLoߍk交Z`?loOs>|-$EX6"Йuxwq,BDth K%qc a> nc/[ɡ,WQ[uG"Q01TQ!$TQ!T:ĹqNX6c$ K+>Ţ!mS]u p.l% H9edQl`j`O*ף ~0 !ڻdv6\oJ!>v~.b،`QfsqJg9K%͹L HDT.xӤsFn[ɂ+14N#/bIhbۉ Km.ngIÖ5彝LNYi]1թPguQ_mW '3\hٕg8o$ LBX=\1*3 qe4c?i{^@AǼKx.[_؟S(ƤX9"ȠndSm&eVʺv|p^Tȼy{^}EˬrD, :=L DΪ|İ&^e(#S"gܺ1m VpI6FLnY˩l6keF5""UUU 'fv]EVVeo,ޑQbm*A)9O9ς%8q;D+8qmdUK!lnK1Q'`M!y""uj! a6Ǯ`[b;H؈'ت=6sʴwHj;B,6MLe57>QUM#岽i?#`Pc(,{un9[YJ-4c?8=LyL:04iVoش`f6 qWuuXۛ Ʊ\myE[eF&IxUXͭ5}P^8#f’ٱ!]bCf٠' !窪艪()M'WQ{v}]J|inKm%dlD1*O\Upp̎$MñE[!y$USyQȕ$ ܒ۬P8}y~\π?ȧ{|`RF( 8OM qBOqA Wj(kv, TPU|t]" 5K,p ~SM󤩷)($۫i,Dcwxu,iL2W$ je5xYK\QcCTUd*4 _[oZd'{ɚy|R_Iˏxʃg@ߵg 7]Q<웗o^oAIQX$_2ZX~qsvDOKik#-mwGhx8͙|Ca.K !Wadyڔ[ƂomWYCw1Zoϲmj4HǞtWDE_r/Rʇ4ԏԑ #dt5<kۙTRoc2;T7:Yݿ A:2@tDE]]l~.?(kV8GQȊD{Db4@Oۢ:j'y(!?~F&_lT,pio䮺gWtpmUvA)'Etl9 Ԉ<6"*yYb pպl2#+*al{K˅W32R32TAER"U:ι3ky^bɎ< @܈IBHpD<_qFr..mIKXދXnaI [4BBD_ GqzUP`E6&=&dUIǞqǞp22R_+#nC1V1e-.^&W$r'l}ՃHa =m>S -(tͼ1i'qX- PnUՓlHq|6 iF@щlEQs+ W .uD `$gn *.TT**ped\TClյvܧb~$W'@I&QBn6ֆx&-ںCapIW3)K*Q5e,,-,Y_ɻ4rv. y~%:/uw_8@Œ-DSodVF.aGnO: ɩ0B۱F}Q01!$]<^V^%Z胮D";qŋ1 b%hc5 %*+=MtvÏ_]+IDmc=DQ=T|[s%|(~ud2cʡ,mfԇ"ɪ(J><<铎넦8jnH"DJ""'UU_Դ4,Lvc@&'_7ðu-Lt#lsۋd!V]%V2gAs Š#{ 4mʓ(m9o]{MaiS1%HyL 'O}ɵ}t0Ғ4vu]ګ$z1/¿+y-`QGs+8i֑ *^C^ԆKv<11-AEBBME}+]{gd ӊ'^*UԱ$K=pОx مU̼Qk!9*i QK -0R=]K]D~dZd7abhkiDIQQSEEE訩⿙ҥ5ܯn:ԉ@`CEaט`?'K6;87zqq-obN-3gnESآR4Doj95"^2Z'K;TkwR^ȱ;<6+I }PS^M5-U556<Ş 2+i}ЅRT"GTZc+63X T܈M} wWބ%Q1B: ۬ӈ@N(**.x(uko Hrkk#hnA>6)j͊)B˱f7n-O*Ul:W<# >#hw⽷G%c₢HDJUp/q kszvh-Rv.s%`q42nM=u<ڗ_\ؐDܧTET/g01ۑ& EEŌ1Eqn=I!ꄨx? {λ|=E;.#%i[ٯmltF% LjaWvq'zH_14_36 y!IND_HA$DBk+ n%_z]-c&ÚchoðA{|I=E^(ڍ,v؏1 {MIUWU_"d_`^5SN⎭C:mAߗ$a]U05릉:BtvIWzڠ b7CHO%"еD;V#r*WC IAS-J.hA>J<ϙIq!Ji#oEq-QuE>}?$ng1Rwq[.5_اː,Gh$|2%iUBoqUr*k(6q8#6+s&Z%$7URIqSP!,ꈟd?"|O;,U|;75=̎hPW5ERBMQISL^@F#L}W!(!iDsm5Y,::6aUXĮ*$RDO,$yddbVW豌eGwX͔M껴O+P/~ey<6'0 L}V4v#¤;z'2qھ)6:1v܋cQG^D\Bژ~*́;rG!UF(je8h@J$1tu:qqpyLu\%7qU3pUUUUUWU4N?n _cuߥ?-/O)닛55_eig.< 1['̝6SF;@n8B(%ֈw.9jB>*p4B]Q`b,V*KǍ;fxŶXaĜu\$E"%DDĦ[k"Uf`H{ e] }-8:! DU_<1<5ig 2/+)@ĺ˸ 9_rh8Ŝ+Pi\sD+$@th3!_f6/b܋[iu_&i_S^mq[ %YXY: MĊI*0OkrFIBM355N(ЕPWˇy,u(j8R&ĪR2|eejG_Vξ8Mal]n6ruXqTvUϮt nDI"ˋ!6!THUEjͳv#u'E>ͬ6]9̀>м 2Hc/?ERmv3盿e6t %X.Iܪ^OJ?Nxo"^aY%FIZ*^S5)%]&j $_Ki+jY`VMZRXd@ե%NŒ((EHt%2DbJ33 ibáQX"zzM;jjSm,6\H5qsfD%_>'XW.c_e*NQ.$ΉmB!'TAETD_._(C?|2gyf;Q~>|Q#iEpc*jD2 'bn&#= w&=s9jNd4rdi$h" *****.Γ=J=jq.Xx$LQU94/JG#4 V'b =mY{IfʭҮ)L.[m '!#32AER"%TADUz"xxjΟ9ar"N8cmeԍ{m7+/̸ 4Q[Ͼȯȴ3帮ȓ&Cn4DDDD}FP9;r0~? _PB̌1-[<H~JB.y|e-M7lǔ@ TjL?maIsEQ)DOФM[g]5#La"̅.;.&,D!1TT<븟>ȸQ ԣmIL%?0Ic\r"P19!BXZlf{H9@4D&"} dK5ĊB$m-jDD_xoɵo0h~sčwJZmM)W!93Bȡr /S$rL*>Ib= Qۍ&*O(obd(H鬥=+8D` H(?ERmv3iEs 6$"l;t7TIYQvx巊=='GA, ٜi֕w6^o@̼Y[SI~ubo 6-:@@5qfgSCV9켑0l%ݕ\61T%~"e1!(6J9L jtV*6iG*w@.˔*hBD+ ߪj6Ję4 m1NF k/=eAK%cѾF QjVG;:(i¿+yP[؝L?g:ByjK_vI3kME;UQ|((訨QQ|8WfJ³i0ؚj"n̰4J.G2,^"2ni'ų蓡gUM5]4^vTugf U,_bjAI 1ܖQQlIE rgYNuA (͢3 @vDlE=7zqq-o]j]+;͟`u&؃FaxLmC *1|ZG$>Zl$ ̴%DW^pDEDObԙqhR3z-7O!=`M"e'@lEm|ܓ|1ʲ EkX5"S}kl rNfh(YLßlST!uKEBIU! $Q{*<=Ti] Qt+ڶ*\kșS-~CBi]ePCuEYe ;Oc(+"aVn,VWR2MJdDJO?t|l~:@,_s[nDS׻! .p˦mq{*)H}Y&3@@ʊ+\ao"İ״LJkDCAܺ(41qےMd+L*n "*xQQ(t*r Q9ZEզuD?WM9\CT9"2eK?aᡨxmBݤ{LI, ͳZ/>CP*ϔKn#a q%ƐDtO,HN5#ZvH`$F1eE肏  ! Cǟo+.6Bi>W%X@uF->H9.'6"9/l 7eF{YҙQg?uw9>y6~jo+$_(VE:krUu_+n[.6v0D7I-'62Q|?UHHUUUUUUWUUUꪫק7~:˖(cYqo!̂g%ɢd!E5yZr J &Vcuba;l8 2Um;D[D@vd;2k-,56ʾkDĸSb>&̈5EEEo3AR͇)bTIq_K8ى***/W yrM ^ӳop tujBv]($I LGƅ^40X=GCCz&W! ŌliHJC -?8UPrD6;k{j63 mŁ6㊂-4-m!xK?ϳi+ G, .J1mSYH#j5NaEx$xssguVWэ[~,ȒA}MI};ǭ2@ŬrIuzm) ةF^Ba\`]._`_1QBW*!P3*|W?P_<}65{T<Ȏh@@yu ylI%1cL{1F4.JqQo2#͂$mj Ű{5fvm)&/ǸS"j TuE]"i U}ECP8}y8r&+:vvXê1EY.lUuSO{d}쐿ϼPY =B>O1S`.+jg5 *7^64TUuD]QQ0W;aqe7 őhD/O N8B[ʓzU*!.Oj(ܑ̊I1.&B1[.:oMiQ62F};D`}oBj4E7n@&*a&01 01BEBEBEQz*xDƸo7oJ ܣG\%2gPEz3bK Kėn(*dvf0j䷙dju>Nt9CjDYLKM௽ SQHQUUWDDDꪫ77fR뤫j ihx2,je#!0m@U!Ez[L?LA6{HfœkDل-:t[>/1U+!5Li7\%7E7 TU},x+1Xl;Eq97 NK`y\#rDG`xs2)qH|@їjۏfҊ}V di!EcGВi-EIk3,S%ĬI& h-b} 4_Y3fH4n VuD:ɰVȀr+J@I%X*>;5|Vka7p#mF逊{AgH_?, Y R#SV0GyL6d*S쐿ϼPY =B>C_"22n*0J:"$B2!͎m"! cbPEAUtw첉$vuD"9R=^\C7#M=SfF>=Pҽ[˻[1.j'N$EsNi5&;Uwg{:\'w ![WӍ,7LqZ]vwи4DMPj`*/X1diEAVGA4B} jVp_XEblGD[uDU4_ێg{ܳ "{soFw^$]I}<8RVJeLVϪ馫l0l`,M4ؠ6m `'ڏ=oIM$;}>JFOx!""BVc1x솪[ZeUWDDMWoo>]U\)V6vv2_]_6|MC8`*D'<6rȱō=Kj{jMgYzD)HMјponQo̯\?r[w͔߱;KcxŠslL|l7'6#TBG%ݭ/`Vg9)XNW݌¿&`ouEO=q `ٛ\)[6o:UE7t_Y=|k~-ric˛cnb6ZZ: J9eSYEo0O-iTRlFf68ҺgO?x98}m+fE] ^]Es)(%7g:~|r>AuF95qh*\;_Ǹ)[ 6( ͻAny~8_i1 \{bƢȭhC^c|孴`WS$ {aH(f=ymz8dr^Moi$e/ֺa}g5ĥuԑ& R-1y!ZVKa[e4nDIf2"K!&%THIESԓ܎š;]N$k;DթUTfEkh3h\/R d?cbdeI b[~ y1˔Q쾳$rvY(Cm:KBDL듩ˋ3ݧboX8&As"Qf.QҶkj[ߏl92$ȣ삶,UEdQPV("M/lLxL>I l'_A"je!V-\рuVfx6EH\9`nd'keh7g;-FJ.</VE_m.}ʭ &uE ɞbrBk3P>jS[sƓ0ef>m\FךFa[W7#QcPo^JȂ4F]1l n82`$}эfu֌!< aQ=Vb)!x}0Dk| sGܷ 2iq!ly*j C;9"Gq5c7qi_w(sy<>:S&X>P95"do̓qgL!Or̳GaX+WrsxDc 1 K]M<[)y㈹ NX1>9&YuXkMD" e5Mv1DwC|q0 F+z#nmԫ4FHWOk\c ;B.e$DV+lRu>S䕱.qoIuS=~]_:MlI\9g58K7id8pxC=5f6^| QEwLcd: e\5J 8v+*@wq ImQu}/V>2WMJj H"= 4%^-KЇ)p&w]n=bPCߧ]˱hݝ`nC*/0n`pK?V9?*nyEx̽b%ũ܋KZ$Le:ӗ;,ʚ+*eab,|~hÔò-F2'\搟tf93jg$eyKĐ8;4hd &)r=.O3i3 h'\ $vqJNf8+#>qPYZ~V1SW܇r&h1XeE SJ]TdFJl#Orw"8n$m^1ZP" U5\ҧ]!!xl]Fv0FuDP Dt]5V3i5Vx[Uiw!Ĥr턤m-\d ҄$'yky s|8,B5鲪pmF5ڒ\$ED%.fz~N4-*7'aތM+o]*ꜹ\ ,>f#xwyK=!Ɛ 3,0wImz ]UIUu׎۟vݍoql\cdZMi_TSE 2Z"8:7m셕F@@n6D UU5XϨ'8q/&`|AL,(z*ƅnq ,h?'bHw4WUGs- <9Sp*.\+e !NB9~Wb.bcr_II42Tܳ9Σl8$L!ȣ ~-E+bܡ@F*]' wVUb!d8 Df9Ao2r&IDS@S%-5]5f,-oc"\q㵏YP4`v!U]5[~dL_} Or)QIqJv_,ڄ6(4-83^ mpr.* O~Ag_lj]F-!`'Xf}DPZsq}m֢"@oGT @ekr(I@=OIY]kOG7&ئm8b@cN [l }VQװ6YVe~qޕi;C1MblU2Г(8'fSa O!W;"T,nTHB,BW^P*c Zq ; K1ZnJqiEe[:.`pG۸3r*lkc&=cޒXo:EQSj w>'㹭5[ojN:U/\]Sdm) QDD|]h.b\A*ͭwS%iDaW@Gn
Tt 3l7!yQ>g8lk-r:)2)0(PQ[qoM9rŌ ӮcX"YQxf{o>0WHpȪ>㱕 2[6wSyOdNާrkX$'ĝNΡW:Ia_h4GDٲ#J.SǍ4vH}aH̕EUQSIQOK7j +WvɳbofmQKO U<˙SBFBS_#&n+nGЌ.DsrU!sȰf3Z"DF-l#zT/vAc$'.捸0c2ɆۊeZmծ\`NΣhY&j7U?.i=oN͌OhɨK)Drm87Q9LRȰ, …Y)N|fr=ǚ" S6ʜ+fnƙ dgAҘq82pK?V9?'KbԖCs8ոU4tp_b$A:*qMlZu7 a_h.gB&̲7*J45- xS$ρGiegb5Uln򙰈L\ӠM9(o워y#9Ҳ+0 Ŧ292;e7"7.}~QRpѤRl~=L "q +<_/ Ӡ+ ގ2'aT] <C vሰ.1Ajj[`;A-++@ &}7De{io8y# c4&l?-O:jb(O.r[ig6oC2XՕQR5M[ C[8 mx̦v%XYcwsy`o+ZU3FZN 8&àͻ.g`kn8~M5APYYUREptM|5<-rPeȯaE;DEy $A"򈊒( xUU2$weɐ]Z ̎Ð8Dq_r8s[ ec#31'(,d9M;5$O-y>.lŸc٬y,{%kݫMi#=L˜ytPp,Ʊ9oË)ܗ)AA9~&s\rFiҏ*BCAg-fYܹK ,jYg-z[O\ag2Xa9x|ux^&Yi3 e&Yq$wW+K9g ^0\Sf7r 8< u,Tզ/1V`l\?K]\<#,ʲ2bU|:KﳊaiN,U]7e<*LO&qgT\7~= yE r<*Mo'MugƜ"m'9:w{_`|ݹY{Cl՗70C]LK!&h挛 5_;tx N|n7 Wf뤯NhGZgU|9.)OU,K.t/ҥOƲܦ4X翋b,Ҧmd qų^&cUBc&,UZ!R)YqY4l\[~ jGskWGsi- fOdC7 ~5~_/G0|5q/>2^ɲɭ"06PGm3HbK*zb<{,^nkk\UMz ~2~O k []o#!.J{Qjhy>[QS_N'a'M[K\[iE9C;Shn8LOWx;y3L6鵺%Q/X"ǃ v!… D3Bhc2 xDDDOgV' xI-^'AIYvLtڡjK4r g~^>^2QU$ExMeQSIoֺpTT!Gv'9 qOgdR [hޛS$tETTDD雟 E.iřlE];5Y6E)nڸZ7)kBOj?:y_e TH}=p(4$T/ܓ>=68-Sq`TQڄ(މCzy<>+&Ȟ8FIsmfՑR]-H{. lj1lxxWʸ6=:W׼ZA=}t6mQƮj i֚s5҃|qFOž=Jr2ưopg_*,N Z,Au[EM ^1N4m;\ⵋ_eǛ9Mnm3'vD\>,e4fj2L)ɱԿ9n8{ڐ"9ՎOL!tXM^'d EܬJ vhInnS yJ $d-UQ:'/ x8^bLVm4څ6п-k;|ԉU|q.cQ3]mf<{j,ұ{jΒ1$R5uS=iG ;\&>֚zm`IhT[(U5_HaZǬ%yo.vp{|Myh"KU&&w 7"/'X/i$c$&$DL?%4T=<6m=  +# !=ȉ\-ۇrlv>I ոd1#窙^*T|7ʯ_Nȹ<{%b몬za5,܈r8hyp'yk*^:%a95Hm܊DL1ګ vE7\k+nqgyog(zҮͰn, f"#5 FzlSC'Tbf9KȠ2ܷ;,DzK*//Rrc,)Etri1oXʎ+v[Xrϫ@//!JzsGĦhI<,rb$iUN!0!0%BQ!!]PSEEENӟ']<C["<_C=Qy%ؚ]W޾/Uޡd om1/Q_pD1^/6 QQ|\hnGL4yas?b8VWʼYIsz7s_Ul:u( K@fcȅqeq}uصŞ3Wۨ3+~dwMܘneEm!|Qj- 9f%10Zj"8Hɤf2*[ΰL.òKA>=5LF7}[/z.As⁈rQIWO"ޗ3 I.;Mo̗Ygywq;6+"aDu4"$r;Cx]&zl~~*Bpx$ &vA}ILhF%Ųzw!ōE-VVOnGtGƜQ0$T_7蛋?zߎC[̟y?\sYǎ,›Ǫ[.i#٤sCM9ivv:BZ *poŭx lC묚ҽ#BuznEϕ1PEҶK+tEdqD 1TT-6*DD"(rWd*"erjޡcxnXZ%fT*ue17)Brc!}%GqjIMP$BmzcOk3YA;>"̊^!O|p Tλ9KUa2VÞh*XoWOImlhO- [ﲞU`VT~lߚ7DzC2"a2xѣo?![elI^uAR"TDM|`JpWȣXHor*D?yU:MXr L>PǗ|, &BpEF]l4LpԾk{ 38"?ΦFUQ dFC )1d]Ž%mnjjg1q L_rqŻ}|+`ȶ(2ڑhpl/K8\rfTIqs>KTi HYѴh@b$*9ˁqxqaoYb<*<&ΏPuklJ2lPoij*O" 26.Γ2bʌGx PQQ-6*DD"(,qw m;6߭F0*@葱%ʫrW/qs'?-9YsEy[m2bqMO$.USѲ02̹$8Nv9[+^OdT7U5~!QO^}/Mc(Dxoaax^7mkQDbWu >9n+l$ ;+NFɢ|sVsϗZz@؎cxsF3HOu J6E,CTW\3QZd=gtAn%/(Y.0k̴x{!˫ w;pFi``\nxeW'[.%9NldFDg*.@٭2|V?QݵJܘ)iM8͠<.pE>moEcc7䊹֎c0T.| pJdߢn,K~9ǣo2~ s'gc8[? oxnb[_&DnMd7,}Hb TE^2+ʑ t9MbL&,\AqyDQ$T_kq_} TO9zk%UcO36_Xm8(:Ez؛QkYsVOc}v734ⶳߔ֊,.Sf+Ɏf=;: cQ]J]~Og)$ح׺ b_wKg`0n9=ym3[DfK[˰1SYW_J8ܠ߾"┬2%Br˒pZ2X$9b²m7QFL{{(n()&9ǝ_:+©8BK=C{#1Ӗ@'V M[QE:tOSʜ6|VxS8ZiBՋx ر`F .3&?ި^Ya뜲cpvrFK(dˡ5U]{zө!f1$6⪜ܛk5{FXpXkNF/Iq&FdwŢ2PDU]kRO_Rmrg!Lz`HbZ`uˉ黆2XMͼ'٪|3q7Hq2īr;PY()^!jR\MI64 N/)SeO|ۏ[}]e!4]!ߕ"< .qx4a8Fx)0Z&_hQaDG8^g곔㓣;4S<3" W[YA(.GNr~ArQ]y_Uapq7 芊:bw<-ؖ0Y141V %$.m& ^H>]<{ι!TO$*$Eq#2L/C Zd>.#)YcM.6'2NGSpvg8z2d}coWJ|qOiaZRSMjm|'O6i"8皚8CWf:#68 >No+ǚv  胱߼_²8$pm #9>+ɯS-(^O$Miԍq\i&#7mleȯ]͎íW i6ƸUpTaaX񚨴6`#/Z/M̸ǧwbL(2)2DlP'jŗųf+,Q("90q&ʼne&S0(,eJNɍ]tO<9#&Nat!l"#1CdE2fAmN2<ӕ$c/0Kgk$28o"9.^H.j^6 纹u#_3@n"I |)r|6#QM8 حxpb 11Y fظo׺OȤy*J7v xf<"g{N"("|WaI(תpNcSw-xW"$l>#`12sO+e2+id WJ%9CoW"4(`坼"VFzYbdleSm<[| x+Tc,Hb%Z2L& Zki\A8c70܍ޯ &Fb!|h4qzx;vRe6A>#,\Q7,[g RD0MQ|pIm>x]ֱ24s#G|Ewi5.43<:CdUB–dc",BQT=92p䌿2L֮ \KݍEՓ +,9/:;neDTHK‰ HQQQSxzO|Cdj-?9iVN 2uR!LiP;S]bAǼUrF)E[#%*T1QO6c'q97:lmd&d, cEbgpz@pP\/c ;-e]Kx(d썃*zwŞ;Ud8'(+[SWmZβ{2!O%Qq@tTT"xV156j ~zcM#I41v b>2!ȹ_T0+j"?ҪٍAujtiMW8'CM40cQ\J*j؀Eb5}t͢ l6""yǏ0H ?'EKVW;9&fUML=ypRirƎ:"v)͘@:e|BȸӮ%/-yP@sɗgpePyՍ~9cTAz<#MWȀIHIEEx]eV2eyqrg1 So*:#³|'~ NP̲,;|.s!cw, $UE5?4p TKXWkXqmR1i [#A)r+b;b "'LO<<{(yEIYq6Y7hM| PDHI4Q$]QQQz6UW`Ie?1'eHGNϙ5]e5R=.3 o7SrfA:ҩ6R#c8G4RiMv) B8xR8A[U [a'b+s_K)+r,z!E2|u!EPuS/wGc: cuć8"he?|ŦU *V͒-x՞7-T%x=$*BMa<-ƘW͘:tV=[AdmCR-lQ(ޒ̗ڨ0PiɣL~]}"Nd4tQWsü qf4y܋9~r'Hoȯ`6i,)q=A\Y_XLaqo1 )1|x9.dp7$\YlEd̒2ډm.J\L:@IԐoq++[#!Do\{*rO(3#*$Ke,w Wɝ PU\/zC>5.Bβw-sBEMf1N (V,4Q]i؛e\Se/+.,wf<=&D f|<6t:uWzO\-a_$|*sp:vmGD* tb\iי<=¦m|@d{$ҟQEq^V/&ݳض J솎xh Hb̒mqЁDċ|WaI(תpNcSw-xW"$ ӌ6~{V?Wr Jd,([Σc+aD(Jͫ6+Ș] ~AO LY3LHm1$EIV7[<>+9{T:5R%n-"!ft_$?&f"d1xr53^fbɗ)!;bh.sbg/1)ܵ GiQTNkU 뮨xDzWPD՜(e~{L)ƏQ]DşM̊vO=Y6M<,xyEmГBW{OCla[UOe]%f2hBFȘꊚye .ixC|UW4L]|K8]egeГmEy`Є8{{5\6sћI.:G6ᄪ^`.H;(n+o1aЃlWշ7t\$!Ub L!ͪ[y**I03'mʼKeTGUBvN5ٵ '%:ȚGH >(ˌ*7E^t&Aأ%}Qۺ2Y,`EiDj$F ,)DdR  C .ASans titreb|{!QSnj&Dn|{!QSnj&PNG  IHDRb  iCCPICC Profile8U]hU>sg#$Sl4t? % V46nI6"dΘ83OEP|1Ŀ (>/ % (>P苦;3ie|{g蹪X-2s=+WQ+]L6O w[C{_F qb Uvz?Zb1@/zcs>~if,ӈUSjF 1_Mjbuݠpamhmçϙ>a\+5%QKFkm}ۖ?ޚD\!~6,-7SثŜvķ5Z;[rmS5{yDyH}r9|-ăFAJjI.[/]mK 7KRDrYQO-Q||6 (0 MXd(@h2_f<:”_δ*d>e\c?~,7?& ك^2Iq2"y@g|UP`o pHYsgR@IDATx]y%x^s"A FHeY-Ǒ=W3{wgm9HTd#@@" t={nsn4{VuS蛰`!`!`?G"37p9LtC0 C0 C=\o8!`!`X9F@'{m鴏Էo !`!`L Nʸ^$q<*Қ$uk#Kx0 C0 z#i }h댡]]Q*eӌ6 ]d(AVv .y-}>ެm!`LHNjG gmpy.x 8Ik孈l(GqN̚\e f^G-+C0 C0ETgHclg4* D}A Vf" oÌZp$NU77wtJ!`!`#nqX ʧu+qr.בMh/R6cJ(߈Qx0 C0 +x|h30?OܿOw+ !1VVn+¶}'Kk0 C0 ۉQM |GE{#';'сp93얱!`!`W#`jDnt! H^sJjp[>a.KHKLQp );v{Er f0 C0 눀DZ.-?vn_8a -m/ /5]p%F\ !`!`\_lA>~dQ{hkΝm ZxOUJ̟;rc !`!`\GLs{pY!GP_oןL.WgRYNz4v# .OD"ڙS'ad"*k"-pQK;Ҏ6nLցΎ(:x#!p0-??|f'kToPHp&>wD@_玘y\ɨܬcՔ!,C0 CZz[O"GQ؊Vt$#L@iqiaJJI#,Rzy"I.";;Ԩ;PVTV.܊%g97W,iHɵ)BUu3h^ٲ'.ՠ3C~vϞ'] 떢 ز&Gk+mek։X,N&R8cW22 dPZ¢/3HH>be=\hveT5$ ](Hn^$!9"(eaI(>HhY_*zx|,mx+嫩k"Dgg\v5MPGv$i_P;"Ѓt0 C{ZP1AwYnkΖ}xQCKG;bqbXa pʍ(Gv$['Xe`y6<灓pm85Av *ڑ* , "a/n1|ڥΕ(*=P=Hv=GQITSe'RGcF ex0yR1eɜzc!`|cA{sv ƾ#\dǃܟS} 2"u{ -0V/-aYct!y7XӽBed!汲R-jƇ|6sgi,4@0m Hw?h*@S骄tw2-'[w>z:ZY<<ΙHm0 CU*N;~u(Z|vw1GSzcןzj6s$)}w!1SUpccg.rÁJƏ; W6/ YFymבwV;@~ܝ;w4"YACG ضCf<z1@*Hۺ?~;7:S]q4X>܉5D@]NzxW O_2S5yg@}W!VYֳdqItiuUt$LGWcsZKv !+'~m&IP/?ز 5MhQNbCgނ 3τw, C0nRalg/TcJTsq4XW>P&:~:eKړ$F;Sjq-ExJTih).61^wG%D8GS8LjMc_-,^˩4'*h˻[㞤mSK}Hm3dt(u$ +?Mw_'/r`i`=MDrzDøg=sMm#@8{/TO3OC > ~F1UJj/s[xr_cT@WTdZGaY6 C0^6I{J5#*Za/dOMkPAVtv!ԓb])sԥԗ{孧B}+Wֳ׿tz3_Z#TMO +< $* :rX׀*~ȳxf(!3!!rZcGtMk[wm-({HĿ77nq&3,fZ;P_Sz~C<Qv7y?5{qEٔ*I%!`M@/#hFc'%P鴚qj6=J+S\P%o25N ( n$lB$PJ::"f.dU6im,ȕk'ÉӗRNWi AN'Il>We*pSɂY& N/Wa,3C0 C`zyKɘYVeS:";58})͚J]Ҝ@9j߿}!kfbn>=#x?{:~%/:l(.M/!-<&i=M'Lpwue1P^<]$vaG[,EkZڎ'SMWuiLŵ'%1JEkRn.&";@> mmq=5"!x~ !bxM)/X$8=1eK$8v9U^" x=SA<zH<>j,B(!`!0z[(]K`3MwG4du]|*lԉ{wuuw8LR#;NžuL|U=s[T ^_]i\JirN2&2% ^- DGb5QNLA)^_d=,*w_t76c+ݧi ]}>$\`,&鼍y]2iKa^u-wOɅx5@|+!= qDشL*-tWl|`bP>.Ъfx#a,6EOo&10!`@/r.5-Hﻃ;0ͻI\b.NNQ==풴=ҴL˦N[rh++B|eJ7`ja!..Ǘ_VqqF=M}x 1SI$V-ԠDM2#EnwO a*ɠܹ {,}nb,[/tJ*ۙ9k#cvdڼټ)6[w,š 5.ۺ(o])hpA.|8Dy"_ _ Jr1{Z I&!͵%~3i2lt8meI!`Eퟦn$9VBvOkM} ZЂ|^iK[`ɳJeiMvp[zHѯK1lJ33<Q_sEy-?Q4;  Rgj+4=A? 4Hi2u&Fn{;&@k:Z:mimE^'dknf$ڰٙ$';`L?tH;/8Lڈ7c̅4(5JggW-!` ^V4ZWiq>INPw%wJ;:0Z׹XrJJ|Oȑ7-^MA f{pخ4bFCJDQ%v `JC=k]Z-k!([:~փLt<ՇZc.Fp4e+|nٔ>e桞ѓ`P:uetb~z\聛w!`^Vݶz֍ Tu^=" ̞yYbҷ?|~L1\io˝.T׹գv-L" 1x5\`wb^qd!cq ;7=3AiUeZq;9L-\utאny$ɽFi!`ac+Ըc[ K}lolB% IQIlI^>s#D%INbm[=@JqZƖ6ۂ\MnIF K0 CLr;1&ڔB;9s>"' '#';N! gz7Ĺ'ƺ5| I{آ0r’‚!`!`7Fnqotiөj (tQnᙳMG=x,1&fJ(p3O4;e%%; C0 #7gfKg+>Bm_=qUxpByk}ҦSt9$w,)/o`W C0 C 8! Ȁ4:.5N1T^ZJʏ(P+΅Nh!AVuѓɥظn sGd!`CjED?=U{IdOGg*w?~jIlm ц$#~v|6 gmS3\1 Śų"Wf? C0 C`8hY#F vZ'P_ 3Fݦ$8dI,^TW;NԹK'3s:^3K bB>0 C0Fۑf\'n%XF WI C/l߇SFO=n]n; ;Z.]8sfMA{;5H G˽Gg!`"0^~Фor%[B۶j׵RA.DlCAӅiHmX:2nȜ" jnZP3W;Nx?VJgo|r h " !`D4Ӎagf̖:3/ٷp|qAkg mbhnk?ލήiEt4ZY o:xY|zS'p=cie!h_Z̫miasOuwgҏ\=>o~ fJ C0FQCJ@ZǙ2iAqG5tũܶr[q/ߏZ-qVz 3FAr\EigpG+*7en 8bn`vSV4qccttuչ-ӤE ~!Q2]i]]C#Miz]?imcs3܂R'Ȁ}~o3x`0~e.W>q߲[d[9z ˗XJ!`7)n&-Ojìh~.SPW>~13/6,#,=ˎJM4Ô|C'~'+xúhꞌSZe6<΍.l0 CȵsEM7T;5qN&9mJ ~Ͼx֥ e#*rɼ;Opyjoye agsB)0Sf0 CD`x&H_v1##m鑀ҖO) )]=_ _K³SHɄt28/7w]5KgM{#4;B6mǢ WA?ʒE˙ªx<|?y񗿀RôspPy1J sWJ{ su ?3Ocni!,d'BP9-C0 cXYlłؗN܌iS,-m#}Je܁2冀vqz{rNmV-G=pG37/7g]Ym;-{-2mGkt%T*pBL?$~fOB;QRĖh_E@gIk=l&#EnIy,Kc C0 !#`DDw(Du[qG3@~)Nw&3Ij$hs'!??vkv|A)Ĺ?эн+qeu?>{'+ފxCdiGgu0[OǽG źUL٤1_3= a|c=+7(fhg C0 !` ePVEeSPnLPjӗkqR5WI2C?>D"x`"a/dgv"b~j2K rl NO6FdF$~:"!'Ec~aץ g`i{OUisݦ.ӎW(S a$_My]P?1bjM;dt̘1_vwŬ)oIXt.ҵYj:ѕ6 C#`䶟D,SG|L< w_g_܄vمf>~wiʊ GSTȴHEdn1X&. OfW7=VZMB'Cp\NٺzvtrEric*ͽ#2LL>9vǘdpygx[j1!i[#iGwbkm¥Aa4# ,!` 0j|İ\ SsYナN_DG2@^mc;/a۾d^tFmuI|wc I ;xqr{^ !`!0>- @ Z|܎vƞg ~n+\u?y{;*hvy~nGy~.6nrtv͝/-@IkmFw&Ŷk!`!)f IKgleʲ=p"?pQgӓd1ΦGh CZi]1ܶz!JsFmg4O`!`ダr)$|涢 $/ڳpi7w  ~?lҏR[- K>yt`!`぀@2I+m_[:;6!L{WrHE-zǁ8w2s$ܭO;4[y~dPKb C0 C`|0r;>8[.@@R%H,p!~_4\3q݊䖺m̵Ӂሤb$ ]j2ֱ]Jw'7+d hk!`#nci\M:7]KiLHxN }Kg>GU{;0j]g!JIhS]Ϣ.Lc`jq!fb!`d#M3"^"dJ]ޱ[vGg[3kS[_om8n_}nYQ>O)wC0 C`0r;N@(و:ҖN$Krt4P z:{7um쿾 DWl<ieBڼXI [<yN뜾o߿8cXB!` (l,_Vږbdgtf i :| >ǹkAע`s$S{S<%4fKҳB]}3.i}Yj{s28rN_~uy $Ds_!n^$,C7|.S_7 N#ՕD 1 f触\umDd C0 a#`vؐ}6ovNo#N ! 0$ Lǂy3Pb"OjWX0[‡D/HbXM ;;Q`ȢZv.#H!-ع$BbE]WsG>n_cN*­ʐv2]@ xMH|zXbr0,m$+0o4,[8988+Y!`@&0r ?i6гD}(A$ӏhL.ef ./-SnW>w;f͘”ERLW> qҹTJVi.dړAr.T᩻WgAdV! ;MCwx&ҮXQCg]T!`!00Fn禺*mm WImS)G4Zv"#NQ AəTfr =P7QX#RZm!` 0F! \'Qgmcd'(mSn\h͈T1#UZ$VUCQ2FפQOݢ44ݡ0(@9'i Y=[ܫDٜ#wa ҙ&8)!e)/y"ĺϊ.pt.t;?anMcfg`2N~J#ٓעlj Lz\`y+0!#13^/㠧3Ǜᑍ1(oX(Y0 C0&?ҨCt3{%7ޣU7/hջxbd$-~%~ƪ6CM:ʩnG8.&E/1GEQ[c msUVMDqY;P[$|ՑNՖWn Hjy]Xa|nOzsKowX]}(蠭m5ÒVbyK8ݮXWZB9-iYHGR0ժf;vԮuł!`!0a At]C"c 3\BQ>29\u"a{k$dt!OȦ6Q'4 6S{ b,SįܻQt D NuW`Z /__{j#M)vDp8ENr&BL8NFE_z[@nn.˭)"~8ys0I 9Pe<ǹ(1&#]w%M$`:+7sQV4Ru+-j>t-Ͽ8,(9/ R5W>g Pgb wϰ 9-!`!0:ƈRcE$n=AEq)I"^|d;u!bqU)h?ɸpzzzlrRLAҼ,QrJrlq򪄛pEs|=37)ijuht@InYY{‚\_y _k5 .!*[xߵ-oRz-oahv 4+}Π l"sIKˏye|^Me?/hPZ-L9&х 'h i!`|&#rDNVJIr1D"%),;SMg "C"jdƨ.P|$-zkIp#_S莪lI챨^ MKSxn]XQF3& PVZ0,'t5gLGNLA<29!J?~iglo ,#tG(iVrA/=|7Z ɴL! "dw;YUKwR]3O<);IrikUnr됟E=BDdŅԢOEuL?]TOk]5TzY x&DC *h+sYS؆XBW\hBGGbheƈe\SܼZX*\{` VazS;Ƿ~qNN B>\FDKE\t4wp36$P3Jz~ aJd4(Bʴ&_{h=zv~Ɏ,*AJЃÖO> NEKWDVo`>vcFn'> ~8:7j"LKd,n[yPs$Mo`/4ʖAiv::jk9I Da1<OτpҦ&7` C0 G@vlIvv"P.x3YH<i\#֎ IdI,~3䥯y|:#rUQhr>i'Zі5U&nG:OY!(n Ith:PNK:/~rv3U[A $9ΏpD!`@/ƏPni a!`!`7"FnoZ3 C0 C0DmIC0 C0 %imٗ.<%+ܕ:\/7">7wT *U .ݨ&`؅TB .{-uu>4-ʥ5WDA>};9NRu3G0{TcMq?[8- 937\%s9ɍa{Lj(nÔTYɍk@ֽ>Pj_9$wb;>Dcqoy2]m5%gHOGcKr65ZA:;.(In &uJO7jpܖ%.daGB\j-rP%%ڙ@m}3& ;$]ҳ%{b=]Ե}jrU-t)^ 63p>Gٗk $QMM/ܽux]&!`|vU@g񎃨Vi,-K(ŪesQ6A'Cp$\$V,S_OU_^sƪE3cF˪Vp[*kǮeK梤 ;E7$uvMvkO+qW?X g! ~mWށ|=mpV0L:;b687W-/=+o&S$I_m]xkliŘ?{ HңaJ#m*/|zv|P6x)NA[_]p N׽?W|qV]x-xeQtvPm=J'7|&Ou J|n|rc|._{)X?i;h#V_७{F;nkMC 1е C :SрwƉ:5 GSHK-. ?:9黢"j/cˮcNs(~,T젦g.ՠ+1åFaH-5_OխxC)&*<i>v M.Qӓx+G C+a[wWڛh}ƍ$2g(VΛ)q&"6?0UK#'/;վǾ`~(G?n qwPݺՀ:|w;08l_~1a z2O;^E[A Jd@[:u+Y/-jhաr>xxoNV:| ?c5<@/0G۱E<\шR^/Tuq&b问~_I{\^WM{mJ7>{;!{__葏ʖHx(\_ᡢIn]@A.z<IOn.?(ϛ鈦0ls{,Lk[ӝH!b2 33A B"^S3)vޝZ^Ȩ{Uyz%Oz'Aj\y-~uBZ&~O3n_:^jt=O+2R%omFJ'U/+-{Ճ/&{~ugmm~^~!0t%zʋi C(9 kVϿ&/<{_}?u/&tEV.Et({y^"bIM^ծsPpn Jdz (>EW|QO^_^D8GI<MTNZ$Ӗ-G TұVwH{:EbPReγ/_wmA\UH}3A/J0LҮS)?w4AVei-d$5ɤ׬^dwMe4N5ZZ.'ᄑ<. i)K8v~QևKZd*S9\|妄M;W_Լo吤#z8׿SxE"T{W9Sӟ)s=C6|*Mb!DNY˾d*ҸGS.n;}8sJ_Vmk;$4$SIR Z;nsƞsF1X!P yX?T[bZ7Sܵ=n^VTJ_y}{KNǵ>|3Ό bYb@m;(Wo;eg͛1P9uYtCsO6ζgϋ(|6TG"jÂ!`E`r{m=i\Knղr2,e33eXOWїS>4u]ݗ`Y8=B/R%'v8.' I:"|yB;d'/eGz֫S=ұS7K#Ȟ/ YT{T\{T[$CuB<(o5!B0흮AqmIW)E3xJ_7y#yyPKpWj'Pd2|ɨ2B!/OaŐIα ΐĀIs$W)ۙ=w$37.mk{=kuo Ϣ{.# UIW 8M.]jyQn=]jWUso={"':t<ܻoࠗ923E;)dRS ~x'Z+뇏7BiXETBxLIoW@?!pS"05`y#$Ο5 ftU5; i^\C7=fvUo/$\)l{g.ףf"|ci{"+/{R:}W k Q\Ta@X~[2kR|uXLԁx y^ݴ ͭxp2L/}>TnYZ/ôiy@ڹ4pP&z$PiEo2-'C<{ʡ~ǧN8HJ rz<ܶj>7|ȻrG. 8:uA%j?޶(=E}T4 q>(ӫkWYtY~<,Y΍ n]>w]B9Bb=yy;hʔa$ nڎOcFI>̜VBYԞ,'(o/1>s s &"xS|r<:>)+ãw*ZylfJ[ߞ>~w!s`z)(K͜޲kA'#^ʍ-,wLiDM!A cV4H$,L RsnOU';yMHS#m#+[17nnD[W9x5rEnى>g 򵨇IkG5;?؃]U[yu޻Fm$h6;:o~@iV&X~`Kr ߼c‰&V77ϽOF ˩o=BS'm+㊦e|bW'?> ԡx40}]+G"#WGֳ#%Eu^ZWghJc8}?zcm.6.ye__Xh&5_Gs&ȍ<~6S\llA3Q WÇ((U'¢yeډx}]M]{𣷷,=rTnfMFrY_Opp&a,r yMN8 d]'0hM;q-S !Q_}r0XviE׷_[#Op73i3x N8W*K;Pe^w׷6~G5$lG:@q0Q3v;lCG鋴fM$w|0cAT1v?5(X:A>,V6^o}xE Yb߻.pv t3B 㫟[ |xka><|?܁ lz䰭ϭG T`('*c˾VFNfY:i5籔seֹ<[8ッk1}W;8YIH^ټ/A/a}!mhwÛs}_>%wc*Ї$zN坾\};-g }PSL 3{>v /,BҹNni_LG 4}俪ێpLO_u{^۹yYVZDMQ#xYŐ.jo}}4a:BP.WơCø}"wKIwr%oMKSrB-ؾmOcCeL_nډ?66O Rv!cCBu` "m n{ih!$eH<^? /qV#7"%Lk m<p}+5kHJ#;Sy]6e@ ,ѣGqE9nZAr1Tމwl d4utŴqǿUY:AN 4ӔqƵ1M>zGNI(mKZpeLN{HZXw,7 XM-_ŌykRuxg d Av&rHr4Rm/܊sI>wo># I*%>k㕽GZQ[WV'd,w4[_vpDEupxΥVuߡøH x Ubǡqcyjo#|GL1T^zseܸ~#x:7rv'HED8X@|ssWp[@G"ڊo?.^b^43C% 9(E\|%%7 t̍s~z;Fvͤ$Itc{+9t'2~GnCQA+<5Ͼ1.rHO/ u-{kzr+ Z4SгG8]g[6D$4a(%bU9?k8g; .-!`\@-ً^oÅ&ji-&IG$|j|$9]^r& ?_NڦX'_~ܩ]a'9rGu}o>0^i)B$]$nobGOMEs^ 4h$:({L9kh$Ijuyh@y$:M2Ӕa#KS$[ϼO#.rWBD-Meie<$ԊV$/96PkS~&̎ csծsVeTW%D?y~76cRAKq.EѠ6z켤E"![jx|Sx~^}H3Oij DӘ,Xf}aBMW{^ƍƵPz$Joȅ;-0˛ŏ irP6Ц4-2u-]F,[bv7{U4u.T3#lĕd{5 泼|%?}fS6هV>$|4w"2ɬf7.T/'MBu ˊ_Х?ۊl! a_hs*b">HY c (֯@RN !` ![upQzQ̴LK%+Er͗^~8q?޴:u:$Kʦk [[8my9I)#r3eHڠ:?RiHunyJ_My]Դ{5]GHyvZ͎&iؑ^y fЮlWyTSw>ƇvFxN3X:iw̬4iƎ&Ȟ''wTWrq%U;A+e$QZNvPDʴeJ/GI] {~ I;Zij!XIv695hk;+څ79CԘL{;%+w-;9)#Ԍ*LJA{0X9(b7ܣ$@ 5O f Yj rPAKk3U@cjnK\Ӫ7g;fL2#U1ՙPCctBc"@"pO6%v (7[O‹_bUIQȗ}v/繆fٶE;Ιr?yE{hT~٢M,t)\jg`zQ>qi>Ǚmm G٩bPՠZ"'4_`zיs@7h9D#,Rb)Ӷ4-Ycyix,{lH1Lshntq߯; 4H"*?ܺNխWP/wϬ;,mnN{~]tKMsmaeeAn2 I久d{2pu%& ™F7bB~Yơ2f\h-h/m?8-h?wvZ0Paps•{o+Wu >'Ed^,4H?o:DZ4١r4ᙙYVVXvγve:ٙtlDuoO\g4ÕBcgAU>ͳ YvT,VڟC*x^glt$0M =lvfs"hAwclRNlt+7DzCL5*ζ_~N{u#!'.7潺&Dx-2IG" l1K, ^0KY 0Ĩ̲ &D'(C-++qHI:4|ヷ- [ lɮꎃg<:9zf,tlZdMܹxeYEǟՖo"M+W^[ۯq@bP~.ZqarzA][_no]E[/WI?:}4!@TONugMg%>d+-$(_dsgWZ U;²[`6N;F t1@#CYJ z,~@[e9*#ΤcQZh<Т8cuA3H_|-y"*-РJ=ZHUA/m?hIP0RX4~2/|"@^{U{ȓY!d1݇ 쐃Iu^'oxM.|2'7SR:3؛a/ThHƾI&a}p^; .aU/<}VG|>h7}[~^(q%%%p L jPֶvۻNI@A9=52"n&D ,̟#v}p ZNKdhc/Dⴼ#'[Tn<l={v9?Jޣ שGLtdݼ gf4wr4Gm/sxLwD%%)H(,ȲD~j!#6e LV DsY5BgXPCG @j_شؾ.1m8q E*Gs@jS=[bONݔ}U /nPfAܩ_Yj_f Fk]Uĵa릟:|ea6}WKKK`BKÊX8}/{>limB-aY? -( b\(1ڊydp'KUXx2G/UIat)~Vؒh)1C w2;A2HcLv[70 KGavi"tE0Ku"(ApQ# @\\n@Ӹ`V5iv#clK =)bK6oYKNJ%5lz`BIifNa5K ?w cs|vo-kmVs|f٠Ӷ%Yi ktA"DM95*Ee. b4# Co fYVߐs! ތ g_2D3MY~+p3BDyL.CbjTw2Y |an9xt[,% 7mWձHeѪvN:ٺx=!oݹaq2Lћy~e1A .sl q{5(>|qIb1h8* 硕NvzOɐ?KIQ~,,3m-[j7nʲEr(+"!_l.I@HFY~\Ar\YA^'1X,絛# c,.l[b^A>#?|?|₝I6N!FdQe<-`}Ȗ# [bgԡPdA}:@PsbH[~E'm0lP` 8}lDC}/F}b6 .L2od*=P:Q1 mqi1 5]"&Ю\mq神 ^^^Q%0Mp˪QVVbL3V1Ae,`|6ڨ"jKM,>zqfHkݾnAp [eA[$i0I(twuAG 6 L+ 7-\FG˨?j)7)l$u$&>/1 Jy,)=űxu'Gئ XDp &uWu"9zJm~yQS<tX 7ϨJi7UnB;i'#>kb i-e4]TZ2)5+~)V/$3"[q `M #HUhJ]iنcTo (ΉHZ2y!ϲ2^mR L^ $AOڰz^t; <&IIVVo\.Ł)n .94 @t @m( W,,lޓ $;ٚΠ|Υ !>N#xꊳ%sm%N!Qg5UG6c傅Lm>"{4vc]'#93.|_~i:܋Aw &φ <#8,l\GwyNF >\A-Jĥ;f0` ~\Avv8/K1E=jkjMYd:(۰ݶg)W<:ͫY,!E UYX@PPqr\V9jS]RRRld攰Xcp}Iz 2W c V> TwTٗl܁SfQlqޤflRhZ %؟M&'MRMLm gdp{<L1+Pxͣj;:>b= rLd :v I.Gd"$!M[ݯ#Yr% Uƶ>;y3p dpCO)W)̴p; G56M,8g`T@IҐF8I[2SSNR4ɲIᶶAQLUG>Y.:ZKG˗O=[;zQ'ݺr!~h_A(.r"K? K[mH,+2'2Ybvqxu- arnwCԙy h[A IcsЕ渗4WdԇZXF&G t-xN0KF7dC?5s]a9sfAZ 5oAGK3e0X)hNE4R9Uh|bJh%hY` sQ*} R"&wznӹ2&Qim%%%p. શ'rYakPuz'^) L)6ev<8m/=54/ibT1tRdʫfoaŠ6iLJ&$,y:#M~'~!*r9D&DF[S ΠxI #M箋t&ʝ+Y# 2ZԏHCʌIL8c\amEN(=M un&hY  GÝFEuuHb$F4Sy)ΉEnbufU,|]Sdʬ BE 1F\c@&G(՟-T(#8!dq(1~+`ٔ4hmⱸeU'CoutJı5؏wGDK)6@aHEَëg4Z yua*\{y.:z:FtP{W˄y@튬(D䬳 \8j\?봼ȿdɎݑHc>b.&N?vr*9=c/Y}reU/}Oi+#'{g^ ឋbuȲOĀ;霦LbE~V Mh!XPI&GӴ4XLU9ډrgg$],`+r1@%t7Js+D%[w/ke3 8*}J/2&-xô?7ip۵S4 GsZ%a@sE&ib)zig,#\x2t>B_o/Ȗ,_|]2bxxq*AXI)$E<;ڮra_>gAgD3Ă#Zo_a%㦙Ø@!n\Ty:z8+wE>]F4֑6ޥT2ʄDH z5vfPwBV2e$؁S[rRtWѤTgobNP:>t mVEBz93dqE VV.ES?JC!^^^Ӓƛi)hT ,SLjvt 0?R/UZI}WT k%o n"G>F1Q1EВ:"E{}sUBKS)4:H4*Z|H1-~W:=1rK6M6++ 7zza`(_:|^::О|h<B>Ct:DtOdp4g* ߜՇ" @NF=| [}@OT,l#0!婊JLsMRa+߫BqV&Q'~#\)ք#_$_@/;hpCj?XT|dEc'i{瀣fl,kCB;H֎FЬhcR)/WMZosmY1Y]ztS|ɐ8i@4rST4Gtmhoܟ,Q{LfTFHX|}GFHiq[Tgk~M#yx`[#.h M.8sZ+uEOHAV,FUu4T[oLHDKyլ6II`{{eACt0v,ebwe0-dV|Is5;li<ڵșj4,?TsMc* D'"mE7VܤҞZͽGd=f3?t.r;-=_ Ƴ jv᣸O!ɱBP]rM1.q#`^8!VZ24_hk+Ge]svp?3 E?#f(:j;gv* Ndlq[ۄ.p8z$'S ;W"2Ѡpy翫u\W{C }vGuY)'|)^Lחq"#dqAw i\&w=nVp}' 1BZp $*"P/V;l6ɐ'$4q@ɚ >n@g{?^&]\(y,O#NZ~%z"bZqEQ7N2+UzrtZ!E@x+֒ XGmP_K˖ 0x>LypePVV{XG'|T!>Ď,lǓe:'xBޟ=kwvo^^^ח-*N9\ʙDFwNTGu[ Sg/;1hsKhJ܋Ξ=` r&"r#SI-Nbgvm3ۇG*[2ItbchnKhO H \[6ۮcl3y2A,]O@Ҁaۇ<_{,f[.LJNZ#H@BnN^h#Aީ51 Y4&f݁soj7\1LbqdQ=Ӹya3SG&L%W=d;vJZv_]N2I-X2yu ZȾ0%*ˢa\>yv_uX}< ›{9VpuZ8g\eՀ$#g MgmC ;m7nܼ>Wp*X`sdFR >g SaW12 Cv\aWMVV92g}G;e/_>?z;qjgabW/(Z 'jI;XtG},yU^=.5/{NWYu8nƟRh//s&$vu~V -<wܙ` j4m .B^huBykI;O (M>΂R:}_^WFЙv}A \s;V0q0\a =\^v:ovヷ<y{7NlÊyN;`ў:x@+ԩ9,gdKKde^`vEƆZCت{, vA8,BRtd8VkG\ Cg._}M{exVumt_g-`OY<ۉ5xAeqg~z-^R@sh7rOdNVxٯT1xnϷI#O?}[9eVN;V-+NKPFJeM) Ggj݂Wnu\!mTG̣:ShwC.d=^^^7*)ƺxm;k58A p̂79\6hT_:;~oc,Y wBkPu,7Ǿe-[0 6E~p&mOh( ^Eւ6S&s 0ñN uZcR-)=mx=m&i( 92ބSl3ּ.1-u߿(t,r{ G >l$&ʓ8]}mp(F`@=Ӑpd(wUhwD7̾L]fTn%~5yf$ m+Vhșjiۯ<ٞ~h {Έ~5^a5m/k\W/堕j]/al˴\FLS"O7d)`.=7N8L k9HilvJEN1 %-9eUMU hWRy2Żqc ]ݿ}=5+݁f}hZxf*yN;2/y>@0E"2Xapd-bt%iwC9%f{}e%`5`q,qU7=LXC&*܊bBTp=$7~;+*WD$XWcANyZ;|鲝yDCM-P׷!y16xKc uuѲhTl?V U.jcbzAh>]yR^(f\ڈCg=~7]؁VxFA=am?蕜E;e7`g~qm?u5#=+KeP m4ʼnLb@K6D2kz޶d,./-悀|~aEݲdh躦5,7R4[a鼫N&ElTB<T/_{.˥ڨfuџT&|3o_}6N ciNh`gQ"SS_|*"ޡFԋvӿ0Ȝ]v)k $Q؂},3z^}P9SeNE W<KTOnW}S1)_Vtw83jLHf|I zkI/el\hi4P,f\5؂ p~ݹn&r998zڊ;s}᎕r&a9?.+϶PK'6i]p!x}:"Nuu < 5ua4wlb&a \8{ bW9ab-kouۡ3*H ɛ&DE8&@v=ݷ)|2 `\kfl3qKԲ8[To=y=mf aq-N T/``mL{ @^DZcĮɈQv]_Bl.?yݾ M7 F3X5vs(C_eꃛl3&Bn))t^-YdFiwj!u#b+nG UK-`aiq8r胫Ǣ-/Ͼa3޽TT/p>h1w| Hĝ^UQ4JoH**G"+A5*cVA jFHYɳ+o_xP>6Ǝa{sgQymχ?mo+;-ߑO-sgN<~x\m`wpq]ݮʤ>]\WfhPEx ~<*kͥ[v6IgA2NEsgA*F&Y@-Oض`/?bYxKPa]jPڂ֏0Vͳmiq]R Oy[yxS]9d:h?FFRWX(hΊ$m[̽,3 -v*J]9ܵ޳מtT VxÓww[܏{8ߺ W;Bua1EW2lZf1%E4FkMkr)-jVvT;[ֶy<[zb9ɳeq~Nғǥl1 COVUL]UP~r:V@Vy2Ս@7~sڅ*;8ܦ]R|hHz ~>)w_65kb‘ ܥ>12v¹V34})mE č0csZpq 0z/&L2tXșf&>F#&x%!Mp4T#MB|=GQKz L*q qИ)WPN&ҠJ#͹p=yLH%-PRNβ?<$Ei u ⻛36R@UA(cL='H2VBt귱1j9@vbot>U& O1# UIc DY $d3f,@2trW^ L*jV4hg/QI2ST;s\woۑ///)$ p{M&?Ǵ2Q[{eojLE;NA6un'>s7M#_ ;HZC4Nٴ$򞘇}9%ЀEhn2!@66SIe$ykOiBx sK S:DPwpS)wul{ p'j+*)RR~J>O /1Q1"3jiYqȕm7BU\ħ<>pH~-aUݧb!rU |A1I$}gCD(Yukb=h7P[!\&4:m;U]LD`dt/_y0ȾL@)Q  #'p@re 7vRKw\eS ޸APg*5C2 pLdal_;$*YTF2f uS_EErM2G-{0Fѵ3z%%%pm A&׎z x x HpV]0kX ̢cكÃV4]}vXdލR4CXcvM9^^^^]~t;>g2-=ۜgw\;Նs5UڕDß ) ,Srp&̼w_E3+r_q////iJi G$myqZœ,.ȶ_}_?dgqg-x}/YMr0<qfzz14 YHz\\v.d9W~ݗKKK,OK$/']X.3M XU֌xL{E[& 292lb [9>bu%S'oXTaY;2^ I^^^^^Ӓȼ4>'X~KKKKKKKK$p Z\8G{T6*] :D2qd:%G7-C^hl)Ғ"7;ܺ _^kj~N@w4'''XFz'Spgqx¯ I?y},ak!1=ζ(`/^^^^^^^V0*@ڌW?`/1Ȏ&{-X*m D[psr,K-;#))k&m~;|₽aol =ZɌu-F%%%%%%%V~{냣ϽgrkO׵.@U5|-.e_ܶ\sg7:Te؎gaۡv~鱻lF^gW0^^^^^^^ב57uΓ1{NGw8Ͻm'ɚz;[`O= ӝ"#_?B{i%%r}wm?t6,gJy x x x x x 959+v&{MMUD^1Hϣ_o>ֵ.:GYglbU/#~ aQ1lMV}KKKKKKK%p p;l}օ!㵵 ׃06@;{]ih{{TҎ>kAS;12}^თ@4 \Q ش{(Cd!{+0%cUһE~ - nU,!6% SCϠ} @4g돬# [E+iqzɮY@^^^^^^^^%pMm,t  EMа@ozRf[Fr.*@&(&b{ot!nbLWx c3;l6t&1& g) SaCcj(pFZ$_W///////K6z"RZE /kυ2@ص~h`G\=?~À.>Ú«\+-!.mH: =%޲2'Bfg%E[gN\o>5_XZ^tynB@YQ^p]}"}&qWǵ 4:$|l7BYdI }mZ[regMc3pztTH:^*O+|Ir⺊Y15T.S71 b&8wklN^ʓߝ+2}1AI7N>.mevdX2q(_y u]+:REvb0A=h,NAƣLn< 唔%3eODqmT8m]vBf_ ֓d9ViM%%%%%%i [A!!] aJ0>mvu5$%W=vR7[NVzxx\⬮Μh%89#W ` ~p \iSgɻ[b\-G *gZKrKBQHJ| E A D141ׯѴm=gjBm3ܵDœL3fOöQ@A-[l3jڊ%s-+ȝX:}Bt;8vΞ̬l[Tg8ZCǫбsna_^h(ޣ5vE$~_8!/+Dcȏ<߽>>85tA^Ў@?Bk@7Yd]ݫh^i>Mv `\R +LsJ-l7.S>kdzŽg{Zk~@R],?#͖ك[֐"L±@}T;(#Ŏ۾suV!<7؁g̔Dsbgr4IG- fw}p䜽D.kء NEi)sݵn!thL'Ϟ}^@1)IOgg\gn p۾CvG"{Wؿb ywW)5{߾oxwv ௿}g>khmCkM[Z:ÞxNk"L ҝP,KKKKKKS,[nb-.!.A;8Nq@0iJK]n$&NDrDyyoOZk_C^j@z\cj=cYbm~E)Z =kN^|={kQkFc^w $h[ZAeʣw,!n,3U;W](wP|N^ o޿X㴢l[o !bv7]j~i=cյw9 vH"XYi@=} {9%{<)326nnҁEGP`:jh>ںkMS#Ϯ[Gڒe6|&dw-Cv-t"Eŗ=` r{{C;]bb;rYjgĽ6l%%%%%Ԩ&Mt-ɳEevl p>.]m3h؁}}߱CjvAmBJGn9E>5&}[=Z9G & !.8h{[--)1 ؀LVsyp{K Ea~?W {|Y\ݻa%aX95'@J!Utn8#ˆCN{-{aa%N KìWtKÁ<'p)†rPNgpѪԞf]\^ls9Ox5*Wi8t;)K}S=~ɔ)LQX.夦XINB㛒n) w}wnXs填cn}C ֽCRw@?8AʛE79ɋdZ E1ȣQ7X$ AZ\/QzVaKx x x x x x |$pk5 A y5KfK&UP%E=-ƇG9!ΒuK5 `0c]KgՍWԅ3XR/$A.o+:38\vM`ه{aI66dI`f6 lFnB7u>6&@wTT^^=2'8ybwvCj8$%o *  MMN,{2۴F<^A9 !ejceQrVեNMϱ6,bm>w%_{蔭;ˊ7Y@!բC_Dʬ u%.Oju0u#Jc$(Hj# 5iMܴSFr7DZ< bav ++̤(oWl//////On)ukIC"p-mqgv7 C?ztȓ6:SHJ:ɝ 0Z/]`9uAtNKm qhuU q.LiE Lϲ'Xc[7-4m;eʁoT~+:׆XݕV`ޭL}{;؟|m(.=DrՋghE3rᱦ^QVċ6u;XUÖjj;053RKe1Uae~`bQdvL:zlɋ>%@ x;0{\F ^yCS|"vv͒:]'hOe/cEZD&;Q{Ū8g`쉻ٜLɄo>x x x x x x |z%pKgr""rsЂ?\`'aІr3v>g9^qpϲ+mOc8?v<1!ζK0>u8 *K'.ڮçmIE.@Gs]*O d[XaŭrN?`lw;ZYW{^um`j}U7`aK[׆,2??o]QMeQ\KNB (~@ \1UCբ"h;lv)r"Qci]e*xF};doq25vlUp0A>A,j/YsȮ;mY*^//////OB%- Z:V"3 ϷnH]i !1h+,7-J VyqV-+mQQ.t8mp!`_7H5Ѫ)p*Aqil>q-_BQ[ REݷ"*O g8`+tƹ0dey9vJ+)eCR v i6yr[ ckĚuFD\d 8iz+lV%Hԍҙв[vXtOF-|)>n1rq;S𣬑 xA y*Ig0kpPL͐é8O'hf۪A) UW`h3Vv d 1IDAT+8UK+*Kl) :[r+}vV$SX,X-j险ltJ**Auo:(h|\SډuX]K9sϞe &-9 ;ɖ-’G2@g6zA'7/1֋fffbgBR% MD|p)#;xv"r%%%%%%p3$pK` `aSU*L ms~×lhEnSs3l^YpjM*g/S1ȲpAuZ,y665Y N] 30U5۽+8uR۶3ZIqoř)v?sg)oKc4oi-G WD%+r-;=\=>'zW{&bрQPսr-a ?OjˠmmSM[2Rvq`dp# ' x x x x x x |%pK9h.v{,@,>I.FB̚ۻmh a4.Ifns@ߖp+@ջR5N3S8cuY,=Ap ZgXF&X.Lt2.Km0Cuhfۿ ׯ -r\Xh{6Gywx'7A4Qe#}T8yx]؎u+hqj[ly4Z rуŦy k 7lf=%_x{ x x x x x |r$pmPq%p@$h`A$qajŬ<q8'#BxSwqK8f1ϔJpҿl}sLuZ1GփWi+ JOI$4wi )A[hj]!/M}:&Q~Oe]˛4](rw! 3dY IُÅ!Yibf_o̘%~LalsKVX JXy UbE!98KKKKKK)[ nq+FZDݧe L&+aoucA(h*KNDB`GAO[HIS-- t"dEIݽҊ tNreW^^^^^^^M p+װlbLC\ !@p)Bd CJe<XC:8 X31m \G9悮9@d%>n^I`2w/ׯ3"Nx5AE$-F8 ˷LBe->1c5mTeR3Vz[J5Xl[ut1TLLH֋%_cᚮfK7{m'pNO4*YdAdM˯r5穩T5 G.ثhj;I[bDH04[]Qjk"nL+(i" J,†jA}x}l0eA`%TPO/ص_Ia%)|*XbԘuE%~8mÍgllx9+l()'쳦{H]BO-Y 6qmhb"6bfZfUWX*V_9|2硁~eJ~n?y};vٺV8yDX/QHӛ |/4gv:zzJBf]]ќf&rgc_d}FpN 8/lU{:>5`gZ?%J;%_Z."jX!+-a |jp~eGWOA!I*v9F\i4!Jnݲb&k?m?{0u,G9%Kn)#=n^$`Ɗe2t ډKtD\{Q--+포¼46:Z;ȹvi·LYBBP }d3 ,s K(YFx-"E,t}GW-Up̙t )18d>oM+mn-t8{C;CtDP#M{}[,P9c2D8jkmY%#+/p)V 24;vN 8'}DREzD.It~Cܴ #z)X&qCZ7q-<@plBذҾs..5knUևU5AxOç,sCO#WXRJämld?!;|2uQiZ*k@efb1f.ZмmZ]cUz1DPEHCg/}WR+O Fذ "i֌pJ O\#,.!F #n$Noc'/ͫ95DrG_r:q֭=WYNƎ,ٲNBärKq)yWN)EJwhr.\|;WQ;T ¿0].%&ZCȦq}>N>RkOB["aN 8'F঺g %x!ZeT{!TP:W J;?նiX{TbI +R7VHz\~꼝 H+}.^鶃d!`+Ƃ8z5X_ }gN_Pc-] WYB%7Z ;ǫj>SIhHzߒlNF5`^źge69 VPŁ}cv!?nWZ|Զ毟nk鷸0Ƕ=ڎ[, ~lr=AP NYy[CwG\I.`Sr{|S,.LWqe4d`] `~yMiM]V]ְ^عz=qdIZ/.:n/XMy2m ;`mXVk1lۋ`R_,>/;Z9hֲv!:qҦN|nKg&9$Y&c&Ƽ*al ]c, %>{ߜpN 86/V<DC$ZAoVjbuEٳOl I"r^$k狻XoOnm6uVUVT)|QJuPȋue[#qBlK k/w7Hg"IGKOK"O. \/i& .7 t#0ckqG] Uldį|Xkʋm TbM+Ģ4&Ũ⏛Xb]}A\#"ѨYЦLY'Zj_"q hޑFbv7bqcZyTf\Wk͗{l{fo&tJZ,oj}]Gp7YZX`dWmkDh|hԎ4֡F=ɡ 8'x#n9UZk}̩!Z{пk 7IS:&A!b}˪[6P{Nnjp'YbLuJM)a !.D8"7K^,?|I۴&w*Xcmi,3^%,Ѷ9PduCʝ" kD/d9J7W/>ٱW,4Z$Æ5a૯ŎC1},ZRg9dXZ}c9?pcr d>s4[6T^JlҼEqHB|۶~nnlKkLbnT߳:&VQPY!dWp5:012EI UK]V[;]JT5R.!`i2o+*@ X ў 7ELJ]._Uya]5iAӖ֨ZŒU?rEV-xC=–cZ>$8Zkß w}=rg=zڪj3}n}-VYN4-/2_1IJAXw:&;ju4*{KU%a]ansc1z9nDse=a`E 9!f+42uuwnV `k shυ3"`D'ZD,(SRB,{#ݴʞ桀^pN 8@SSӿYYYwZ4qcHZC8v[M:Fm&%y<^'dV\VlK,iPĥ4WA(ƫƐ2"3ӳ-!X?ԠZBNķwk]~l ch=Ewbn᫈Gq;x}r/^ 85#o&2fmYa='u_ <3_Q: 1ykn"\cIY ?%0<~}Hkjˉː"`r\'Β\^`$kv&Psʚ"Z,-EWT& iLw5;6KW#.[¾E.f| '7߷O/^&G=;OfڦDl]!#~kۈ/=k ̋pN 8'x*nu:Wa:XqwB?r[y?{Yo!1;'pZG'pN 8' ]ȻswN 8'H"6 qN 8'X\.;'pN $pqÿ8'pN ,d.nܝpN 8'M_pN 8'2 y|N 8'pI\&/N 8'p ۅ{>w'pN 8$.np'pN 8LB=pN 8'@I8pN 8'B&v! 8'pN $ 8'pN`!pqwpN 8'DmpN 8' *++l!/pN 8'?>p1IENDB`}$$If!vh#v#v:V l t 6|655pytS3}$$If!vh#v#v :V l t 6|655 pytS3}$$If!vh#v#v :V l t 6|655 pytS3}$$If!vh#v#v :V l t 6|655 pytS3}$$If!vh#v#v :V l t 6|655 pytS3}$$If!vh#v#v :V l t 6|655 pytS3}$$If!vh#v#v :V l t 6|655 pytS3}$$If!vh#v#v :V l t 6|655 pytS3Ddfd  C 2ALogo_NOIR_VF"`R:"4Toh^F"4Toh^lExifMM*bj(1 r2i-'-'Adobe Photoshop CS6 (Macintosh)2017:01:27 09:56:07 "*(22HH Adobe_CMAdobed            t" ?   3!1AQa"q2B#$Rb34rC%Scs5&DTdE£t6UeuF'Vfv7GWgw5!1AQaq"2B#R3$brCScs4%&5DTdEU6teuFVfv'7GWgw ?TI%)$IJI%F889O2}lj?>׍WWbJt2r(~N]Ǣ6[kǹponrjx49`sNE:?W=>yqm52VYu=+r?aпޚٜڹC^?B>В]?=9l?-%Oi .|}78 ǬTz<4ݴ[_*ح$OU{$0uJ.7}?YhI%>C^qk4yh8:t Uy,;' uw[{-Vz{:Y0!p9}_exv_S=wmW_jJ}]%U?nwMwOS#S9{2CkwZ_Cm6>Cnk\5%3I$RI$T%n3a ͷ\vxok3>vs:]G8$;e}V%=fFv('+"@sk 9¦8-vG/YMYl$0]oɷh`wЦ3\/AnPYLm,{dmwux6Ukt6 N/S_w{3%._gp1Y7]RJtw֊ufҥo_m'2MTݙw2:[_Tuue̵>эSC^Oc[6[2;`^mس]ek;-̌k-~u,L~}/y5dۻRmY]L>U8ev~)о='tjgIyx,m!cﱍzl Q/fWS# L1y 3eWޫ3qsqner|c묥W:jȦ[ZŻfl~6m^KasvTwWs[zp:4vm7u797=5>r[?F, j}u1gۙ^ֆ5ٵWc*=wt*Lin8{͆쩖~w~z(t7 ά7ul3Em뤦I$I$NۍfDCl=eM]?pS~g}S/igO .uwc?vg_pYz s6u}:?Ҟk j)םG+^yuج0lqnRI$2>tnu ɳ̴:w?NGzZOgN̳22WSڍd]Zkdufd7ZXvh~ZOU]ʺs2jm8=zlw_gWEtYsmlkCKucX=][Բ1Xlxl5ZR{+/+Yspz]!8Y{]/'0:c]leVt_~anxDZ~*JzY:> {@1l sae?W;}\x c1 E.l:밖ջ[js+u8M6mmK_J}j={j[_TZ/û-2MnuNiڒ[}jXOSoT?Ժ5Zѷu72z7Vm9y▚k쬾sc;e*{(]#Ϋ+G!_sbbt[m):yExW9_ء&rI]jC ?+w?}Ծܪ[oIg,yaMVW$גL%<'zںNOٝV[_>v<߫X}eY F[k^$XYN_]>}p8}"f aLfU5&]^/]=:=_Qz7ԟ}YwwRʃx">=wwYOtҔ$J|K6%S>7/iect7'Ag}ʗcdSVM6ʞ8-xis]-ْ0sJYMvf>=k}^Vn9a^[ZS}=mWĔ褒I)ҟ 9`kewCMGqU]=݋Y6ZZ /29c6t㊀y15zJt|1isV?Fkt=OIN'[-}a ."mu!CU1ߢj7n/gmucxSGM`4@ᕷƯ)Q7. -h7+g^uo4}p:85lvCSiI"?gֆ;{YKK\ o_[;Cnr.,xack,s,vޓY$÷E ߆^[ko]Wfv, ZW֪Y1hck7Ye_Ma]_sD?^zGKꕊ%9ld '~[6MWbkǶzޅ^$\}SAn6[QpGM:W_~OƸ4osޯ?qū=Xmm^a2zFĔ}Yl2s_i#԰.k=/{7"Ϋ1+2E"6Ss7vzO⺸wZN=`M {=Owe)WӍ~SDoޥw{7دu>ԫ}?*vCcC?n˛^w 7߅$:?wR>;9xnim~ޣC+iOǑ]d jdiChg%A4fͅ?mrf}tWuCU5ߛ i/^f:ݍK=XP:c=s&3g5ꤧ}c?+of+e{]l}7)G}Pax|ȯʘXc-7o&r.,CEoae?f=? %Lj|P?K9Y_"ĔϙOTqQ,c.}oXRWBWa]~Pܧ=ٹ vSݺM/bߪ=7'G} -;eoc{J7] uTI%)y'֏]~f4g:JlUMߍfFms?_Cgn ~O䱿:u=O[4lKq [ ƾP~}~:ȷ]:GrlƭG}o}\ܺ_mɫhouVto]Yx@F@שbJz=PC%mФ}sW׌}\y_Wz?Ti,lmzm$ץF͆w>'tv;˛@8o7ԾY']{nePs8Yfl-};QjJ} 3?K U`sy5xɥؿ\6ҭ^_֯/sKr? 81>aǶMj9 IǑz+՗17ṫB a?[5ƿMebM[[[=K,WB>e_Xu ˡ;дEfϳCwSj.;V> vX[VR9~gѿ^x}RF~n#^>Om-?οΠ: dXUc}ٿJJqEf)iUjz־}a^d>yQ3rԎїYWVmٰ2_Z,w]n'CeV1Xk2qkKVֳխk{=Z۾S>ү4UvPqZvW}U7ӡ'q,G}S,./n(?r]~3jk*ӏN첿w/ƴ9 5)?Y>Vd}p3?Xۗ9Ѱ38:m.{M/s]쿬XNlݑkie0)ᔿӥYo=?NĔTI%)$IO/#u/x͌. ~rۺ[%k7wYY_ڬϮeO6t췩uo!c{?بt߭Vi;>[& GZ+oV֎/<ՁAs1+ɵ/cUz,5bT<ܜۋc.ahOfW2}3:UOn/NW,%+U&?.JWO[*vnk uZVdz{FϠf}i]t솻Y ]VKkHRG썱;z6(޵:^.sC0MO}fuX[}wfSwIL@ų% }UeUj?UF+o*^^]Sepk}_tUb=T1szRϧ6G\O]OkK1O}jƋpƶ7jkWYM~N)ؿncQfmC{l='^EW]8Nί݉ch5:ߑE[ޡ[=M9stoYq7cYc[XYn6s<溽G?uOU[22[qdMee즬_OJ^ν+į!ǧibd76/uT?Դ]Wls3Df?"n+ݟf}?Qg=S'etOuktVeyge,Q_ T溎wPe'P|{uv3j6B=]IL::~Vgt;;C7"Zn}>bg6ޝְK[ew269cԶ}#a<,Wcٺk)&.6L>׻U vLĢ꿛X,m$ޑJZf=f+}ueV)n>]ߢɱAVUٵ~]e9ԽŬ̲kݏWڪO_7 x)TI%)$ILlkuV>ױk~\ ށ{B6Q}lBvv5龝 {^J|mx_X\lf~O[]DWeպ]}Z2}?QU]lM~o\֏[Ӻќޝ]L~a=wJGuOzkMl@7}/[%>>fVmoN[?3ӝ] e@6bW?%oVk[q|}.Ce,ڮ+KeέMcZNjkw?Uq?iYo1Yƺ6ϛC43cJYp&Gi_Z>6>ct+G2|+߳[ѿneU˲.;6}:Kؒ{']E7Rf3:W񿥷ѾH^Lli3d[FA~\u]kM%)$IJI$STʩ$ꤗʩ$ꤗʩ$R6AݻҾWI%>O?n~[\^W7~k'~^\jI)jK_g>?IƟw…i$_??oDzf>j?UI%?U$UI%?U$UI%?U$UI%?+fPhotoshop 3.08BIM%8BIM: printOutputPstSboolInteenumInteClrmprintSixteenBitbool printerNameTEXT copieur-1028printProofSetupObjcFormat d'preuve proofSetupBltnenum builtinProof proofCMYK8BIM;-printOutputOptionsCptnboolClbrboolRgsMboolCrnCboolCntCboolLblsboolNgtvboolEmlDboolIntrboolBckgObjcRGBCRd doub@oGrn doub@oBl doub@oBrdTUntF#RltBld UntF#RltRsltUntF#Pxl@r vectorDataboolPgPsenumPgPsPgPCLeftUntF#RltTop UntF#RltScl UntF#Prc@YcropWhenPrintingboolcropRectBottomlong cropRectLeftlong cropRectRightlong cropRectToplong8BIM,,8BIM&?8BIM x8BIM8BIM 8BIM' 8BIMH/fflff/ff2Z5-8BIMp8BIM8BIM8BIM08BIM-8BIM@@8BIM8BIMnullbaseNameTEXT UtilisateurboundsObjcRct1Top longLeftlongBtomlong RghtlongslicesVlLsObjcslicesliceIDlonggroupIDlongoriginenum ESliceOrigin autoGeneratedTypeenum ESliceTypeImg boundsObjcRct1Top longLeftlongBtomlong RghtlongurlTEXTnullTEXTMsgeTEXTaltTagTEXTcellTextIsHTMLboolcellTextTEXT horzAlignenumESliceHorzAligndefault vertAlignenumESliceVertAligndefault bgColorTypeenumESliceBGColorTypeNone topOutsetlong leftOutsetlong bottomOutsetlong rightOutsetlong8BIM( ?8BIM8BIM Ntـ2 Adobe_CMAdobed            t" ?   3!1AQa"q2B#$Rb34rC%Scs5&DTdE£t6UeuF'Vfv7GWgw5!1AQaq"2B#R3$brCScs4%&5DTdEU6teuFVfv'7GWgw ?TI%)$IJI%F889O2}lj?>׍WWbJt2r(~N]Ǣ6[kǹponrjx49`sNE:?W=>yqm52VYu=+r?aпޚٜڹC^?B>В]?=9l?-%Oi .|}78 ǬTz<4ݴ[_*ح$OU{$0uJ.7}?YhI%>C^qk4yh8:t Uy,;' uw[{-Vz{:Y0!p9}_exv_S=wmW_jJ}]%U?nwMwOS#S9{2CkwZ_Cm6>Cnk\5%3I$RI$T%n3a ͷ\vxok3>vs:]G8$;e}V%=fFv('+"@sk 9¦8-vG/YMYl$0]oɷh`wЦ3\/AnPYLm,{dmwux6Ukt6 N/S_w{3%._gp1Y7]RJtw֊ufҥo_m'2MTݙw2:[_Tuue̵>эSC^Oc[6[2;`^mس]ek;-̌k-~u,L~}/y5dۻRmY]L>U8ev~)о='tjgIyx,m!cﱍzl Q/fWS# L1y 3eWޫ3qsqner|c묥W:jȦ[ZŻfl~6m^KasvTwWs[zp:4vm7u797=5>r[?F, j}u1gۙ^ֆ5ٵWc*=wt*Lin8{͆쩖~w~z(t7 ά7ul3Em뤦I$I$NۍfDCl=eM]?pS~g}S/igO .uwc?vg_pYz s6u}:?Ҟk j)םG+^yuج0lqnRI$2>tnu ɳ̴:w?NGzZOgN̳22WSڍd]Zkdufd7ZXvh~ZOU]ʺs2jm8=zlw_gWEtYsmlkCKucX=][Բ1Xlxl5ZR{+/+Yspz]!8Y{]/'0:c]leVt_~anxDZ~*JzY:> {@1l sae?W;}\x c1 E.l:밖ջ[js+u8M6mmK_J}j={j[_TZ/û-2MnuNiڒ[}jXOSoT?Ժ5Zѷu72z7Vm9y▚k쬾sc;e*{(]#Ϋ+G!_sbbt[m):yExW9_ء&rI]jC ?+w?}Ծܪ[oIg,yaMVW$גL%<'zںNOٝV[_>v<߫X}eY F[k^$XYN_]>}p8}"f aLfU5&]^/]=:=_Qz7ԟ}YwwRʃx">=wwYOtҔ$J|K6%S>7/iect7'Ag}ʗcdSVM6ʞ8-xis]-ْ0sJYMvf>=k}^Vn9a^[ZS}=mWĔ褒I)ҟ 9`kewCMGqU]=݋Y6ZZ /29c6t㊀y15zJt|1isV?Fkt=OIN'[-}a ."mu!CU1ߢj7n/gmucxSGM`4@ᕷƯ)Q7. -h7+g^uo4}p:85lvCSiI"?gֆ;{YKK\ o_[;Cnr.,xack,s,vޓY$÷E ߆^[ko]Wfv, ZW֪Y1hck7Ye_Ma]_sD?^zGKꕊ%9ld '~[6MWbkǶzޅ^$\}SAn6[QpGM:W_~OƸ4osޯ?qū=Xmm^a2zFĔ}Yl2s_i#԰.k=/{7"Ϋ1+2E"6Ss7vzO⺸wZN=`M {=Owe)WӍ~SDoޥw{7دu>ԫ}?*vCcC?n˛^w 7߅$:?wR>;9xnim~ޣC+iOǑ]d jdiChg%A4fͅ?mrf}tWuCU5ߛ i/^f:ݍK=XP:c=s&3g5ꤧ}c?+of+e{]l}7)G}Pax|ȯʘXc-7o&r.,CEoae?f=? %Lj|P?K9Y_"ĔϙOTqQ,c.}oXRWBWa]~Pܧ=ٹ vSݺM/bߪ=7'G} -;eoc{J7] uTI%)y'֏]~f4g:JlUMߍfFms?_Cgn ~O䱿:u=O[4lKq [ ƾP~}~:ȷ]:GrlƭG}o}\ܺ_mɫhouVto]Yx@F@שbJz=PC%mФ}sW׌}\y_Wz?Ti,lmzm$ץF͆w>'tv;˛@8o7ԾY']{nePs8Yfl-};QjJ} 3?K U`sy5xɥؿ\6ҭ^_֯/sKr? 81>aǶMj9 IǑz+՗17ṫB a?[5ƿMebM[[[=K,WB>e_Xu ˡ;дEfϳCwSj.;V> vX[VR9~gѿ^x}RF~n#^>Om-?οΠ: dXUc}ٿJJqEf)iUjz־}a^d>yQ3rԎїYWVmٰ2_Z,w]n'CeV1Xk2qkKVֳխk{=Z۾S>ү4UvPqZvW}U7ӡ'q,G}S,./n(?r]~3jk*ӏN첿w/ƴ9 5)?Y>Vd}p3?Xۗ9Ѱ38:m.{M/s]쿬XNlݑkie0)ᔿӥYo=?NĔTI%)$IO/#u/x͌. ~rۺ[%k7wYY_ڬϮeO6t췩uo!c{?بt߭Vi;>[& GZ+oV֎/<ՁAs1+ɵ/cUz,5bT<ܜۋc.ahOfW2}3:UOn/NW,%+U&?.JWO[*vnk uZVdz{FϠf}i]t솻Y ]VKkHRG썱;z6(޵:^.sC0MO}fuX[}wfSwIL@ų% }UeUj?UF+o*^^]Sepk}_tUb=T1szRϧ6G\O]OkK1O}jƋpƶ7jkWYM~N)ؿncQfmC{l='^EW]8Nί݉ch5:ߑE[ޡ[=M9stoYq7cYc[XYn6s<溽G?uOU[22[qdMee즬_OJ^ν+į!ǧibd76/uT?Դ]Wls3Df?"n+ݟf}?Qg=S'etOuktVeyge,Q_ T溎wPe'P|{uv3j6B=]IL::~Vgt;;C7"Zn}>bg6ޝְK[ew269cԶ}#a<,Wcٺk)&.6L>׻U vLĢ꿛X,m$ޑJZf=f+}ueV)n>]ߢɱAVUٵ~]e9ԽŬ̲kݏWڪO_7 x)TI%)$ILlkuV>ױk~\ ށ{B6Q}lBvv5龝 {^J|mx_X\lf~O[]DWeպ]}Z2}?QU]lM~o\֏[Ӻќޝ]L~a=wJGuOzkMl@7}/[%>>fVmoN[?3ӝ] e@6bW?%oVk[q|}.Ce,ڮ+KeέMcZNjkw?Uq?iYo1Yƺ6ϛC43cJYp&Gi_Z>6>ct+G2|+߳[ѿneU˲.;6}:Kؒ{']E7Rf3:W񿥷ѾH^Lli3d[FA~\u]kM%)$IJI$STʩ$ꤗʩ$ꤗʩ$R6AݻҾWI%>O?n~[\^W7~k'~^\jI)jK_g>?IƟw…i$_??oDzf>j?UI%?U$UI%?U$UI%?U$UI%?8BIM!UAdobe PhotoshopAdobe Photoshop CS68BIMmoptLTargetSettingsMttCObjc NativeQuadBl longGrn longRd longTrnsboolembedICCProfilebool fileFormatenum FileFormatPNG24 interlacedbool noMatteColorbooltransparencyDitherAlgorithmenumDitherAlgorithmNonetransparencyDitherAmountlong8BIM-msetnullVersionlong8BIMms4w8BIMhttp://ns.adobe.com/xap/1.0/ ICC_PROFILE ADBEprtrCMYKLab acspAPPLADBE-ADBEdesc,|cprt+wtpttargtech vued ^viewl$A2B0_fA2B2_fA2B1a_fB2A0`8B2A18B2A228gamt k|desc"Coated FOGRA39 (ISO 12647-2:2004)textCopyright 2007 Adobe Systems, Inc.XYZ EOtextICCHDAT FOGRA39sig offsdescD50viewe+| %z Rimft2 jP<-   vj_UJA7+{ f!S"B#2$$%& ''()*+,-./012x3c4L566 7 789:;<=>?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(魀Lڀ,O;M}\gclPb7Cҁ~ӉY~Lj~̇~ͧY$|#,f@O<O7O$}ؓ/}ّ}⏉}~H<~8z~_d~N3~64~,~ ||͝+|ܚ|}}2ю}dy_}c}ڌMG~ %5|~)}^| L|!$|8 #|R@|P|x)}b}LZL}}4}}S{߮{ʋ{u{֤@| i|Gw|8a|ݕK}4}0{|y{:A{FT*{TL{h{R{ޢv,|,a||KG|4<|ʔ|/`{z{{ߞ{Gr{!uT{Ҥ`_|\J|U3|g{zpۣzpƝzŸz׼h{{At{"_{Jp{쟗3|{Z%zڊzJŊzϰzēvzӽ.{s{;d_N{k)J"{s3{{ z٧zfĬzCzPzűzؾ*sR{^{'I{E3n{pzɑc@}YL}3{}~TtW~~vdTaK3d?1_ˇ)F΅:\O_u ``IJx3(Ã7Ɓ{=1h6d"'҂ t@و_>Id2t/9f>?sUqY+(eő+]pLr3^2HՊx1ԀDpZ@{Ҡ*oc*ەq؀]@NHS/1Y$lj؂K89ԀcpӀ3\nGg 1 PzﲔB_D݃o͜[=F0;<~|f%kME쫻orD[PFo 0w~ՖU}㩂[9~64UmnY#Z~~$F ~0@~tk}⣂?MZe.ǔIpGm~خCZ~E~e^0~!|}0т*߾ ='YeЮeCVi~]m'~Y~c-Ev~W/}ޞ|㕎|*ʌ|fϋm|<|Ǘ7}6ˈ}o~V[Q~Fo/Ѕ/w;κۊLNɉ2-ce02n\ Z~E/(rn6ߝOˍk+q"[ c wmYyDńbL.oݲ$^ΓZsCɏlX"cXzDۉ. ]Q!cmB.-->~m[akD;W;Ca]h-֌TgOںRs2Тy2Ɯ}IjM-1V჋Bӂ5-XR#*<ƈĮl?LJŅ\g|L|ivț,V6)BY-ޓ׺6!{["hmhU͜A&,܁u)ˀ^ֆM\xJ zo֪gUvAɝ,"yC̰pÃ󅍽@„Yyg>֬T,A)x,t-{1ԑQ5Yf'g{\xcfPTz@7,M~(>ז<{{n3{ | ͎6|{}"h‹)}U|~?Au~+dȈyڔ"ƒP TKqfz-Ng:T|D.@3+Q[, w򋒮WΎH(匿BxF|fS!?*\iiXvב@t,QX wÊebRR/?M*=)腰DŽ́FCH]H&+uncsQBCs>9[)!7U%ҩɗD߆àOtWbވPᖶ=˅#)se+Zbɴ#ubusbP 4=_X,)=70Rcɶ)n6β<>drψèaPuCOn='<)֗t4zȓK {/ރ iq`:Ng<(҃ŌNjΠ3[̂JﻹqPc` $Nvƪ\MQK99 g%LJՅB?ٝDϒ3J|kl:[06Jh8Ոh%"*Լ : S{rkJզZ̋I 8iY%ea+wԚī^?az±jvZ0I_ 8 4%7l8K- `E{/ʑGyiˍEY&H7ݢ%(e8yyz{i{p{F{kD|Zr}2IC}7E~#Aae e.{ סNҚ^zQOjWY:gH6"V .(+ߝJBaVy i##XGݐg@69[ " R KvTaׇ֙OxhBX,GB5ȍۈP"yz\ ӊ,ܙew%>jwgaWCSFm5`Z"N܋ XyߟTƜLٙv5(fVDF5ۏ_"29x ] $@˞iXsuCڜe˓MUCE4m" 7&ۢR; Ș?tbe(UJE#A"4\ !/) ڇL]'4!RskZd-TH+D4!׉Õ ~آ!Ž6ȗr.DclS D 3h!i2Hˠw0iڻ>qߕ bВV&Suج}Cz 3p+X! Rꉯkz |ztzG{Yr#{b|S[|}&C3}268~ %pL%^?&?rq<"b0R6Bp1ɒ' [bܬOJ7cEVM͆p`an]RWKB 1hv s=9~\0foI`ԊPQdՉmA1x8׈ >0/;+}g5nu_WP–ZAq0+d Vߦ/ܚ|xLmӜ _1P&@J0wk!}z WЇy{6jS{m(^O<@?'06w k_ݗ<2jLz͞lRd]4O.?ӒJO/󏏖KkZ Y_U&h(y؞zdks#]Nqܟ?] /.V #Lj5yFǖKxP(j\rM䔕E>/hܜWBu QPT3DžEdˡJxO.:j[rMq\>l+/32/j wm?z^్z zwn{RiB{[||Lt`}*=K}-G~1gltװсYvh*ZZKt`NfrXRJu;,DԒ .5<Igcs喤eӢXAI8;\3, ȍB {_¥ }3Ğr⥋)e4WۗmI;V; Ɠ+ᓐi* Іy7ݩ:r#=dOV|9I ٙ:`+ ;!뚍د~NqKcơVS$H{:P/+zb; {Ȳi^~1(pŮcUا/H +9+IU򏖒8 9/RñS} o酪^bUC(G騭9e?+" =6 ىV{7{X{P{mE{`|vSJw}E]}7H~(+Pjřv$JӇi|zK:mS`Rץ~q1Zo8#π)Ɂg.<}CL(pd,KWJKJo>v܂1%~#6ÜGyuQ`|ƿopCćKc˴WbJ>5&0"J⛰)nÈij||bocv勒WJ=h0Ρ=("hhψБ{oj{;cFVPDJht"=ލ:0"ݜ6׉20}{bnbVEJҒN=~80="ZӋ2z&njub2~U/^IEz=F0fJ"5ƗƄˇ¨zqťm aUIrÚ=! 0KN"𚙓0qq(ynmi]a PU>?IG<բ038|"5|;"yh!lYf`TڧHϦݤ<30ŝ)#ae^ڼxภl`ST_'HF<{ڤ0iN#({-~~r}f}Z}OGD~ C~7H+)Ѥ݁j~n rI;fS炜ZKO^?Cm]7{‚+EܣՄ'd+т~@( rf"Zv&NܶCG67^4+(>0N?~/m r7if+ZegN͵ҊC:Y;7R5*g^W΃}̪qwen"Z/NPCF7>n*H2HSՃU}qhʙfe{/Yڹ=NZWBђF7#I*Ɛ3D.r݃},kq;e-,3YVNB'E7 *Xxi<|pķ]dྠZYHMmB}6S+ffOBT;|rp8dX0M@Bp#6񧴜+™@ |r|`p;˯dNSXMpEBPg~6-+-6juG ֎>|ɰosdKXONMEB66㦿l+=ŝ' | ڄ|z]R|z}&{T5}{~}|}}xw~3}b~n~L~~u4~~~.U{{vɧ{݃.|V|̌|w}Hka}7Kz}؂3}2}y㎅z[džzыD{E0{%{| 5u|oN`n|͆pJ}3,}K|ux=yrŢy듂yzPoMz{5ti{?_^|I|u52|q|I.x)0xy'yzFzs@{a^g{}H{2|OW{wx(fxFxNxcjy|wyr6z]{HH{j1{uzvwz-wmx{;yхjyqPz\z3G{1[{(WzVvӈwrwxxфhy&pxy]\.z0GIz1zyَf3v).vܾBwKwϷ͖xU*fx֬oyVF[yˢ,Fz(0zX3yovdYvo wƧlwx‚x~ny h[ysFyȢC0zyv޺v{:5vըwhȞ)wx_ndx̳Zy+FYyz0yxӐMx?yq zGz{`+|q|]@f}fGԁG~0ԁ)~q5!)F K﫶$Bāp\F݀0!rtO]ތ׽H%у@ ob߆U[Eۅ/ʄ (6pZ_dxjFN"8 (n7, Z 8E9<.1~PhB̛~ʙQ~œ~q~3m~Y'~D~G.~~(g~~rȸ~>>5~Y~n~l~+XZ~-C~4.1~^}k`5~?}}}éC}@1}w~h}k>}BW}ÖCu}ɓ-}|Ɍ}}lp}aw}9}07}o}/jn}EW}^C}a-}4>3|@}/}d1}|ﴊ|Y|{|۪;i|VVp|B|-v|͘5K{̎fe}}0׳ |©||{|h|TU|BM|/-H|t_{ns}}nP}lC|˙|T|nRz|\hp|\U|`~B |Q -#|,o{"~ wg&ax$ Ixأy zH~^{$k*9{Wj|B0}},ʃ~u~K?+71~pXza|ihV^B|,7&Zr ^p0>"؆t{1hуSUi@AR؄f+BKPL¢V"ʅynčЌ!pzr*g T@B+>&-҈u.ߗ2$@y>f{S@*Yq=ԇY4ŭbƃxq-eĂR򁢑a?;K*ʍm vЪ)SK2ւwdRK8? ϓ*]MZ]/I(]өȂ4v.d'4Q՚;>g*$ܔc~ʌЅVQDq˃NR8D|uEKce٣_Qv5>4)s~M˞(* i;J ݁t}Rb7P$n=)R}ʑ2ͦ҂]n%msۀǵ b8LAP1=fh)~қ}Ӓ&vl7w@Ύ}x ox·yv[hzd4@{[Qz9|$=P|(}~]Y Tʌ(Nwru cP=CR(A 4&\DoKPɅBsڈb ݄fO<'݅fʃ`~Ԑ͍H)؍@frÈCa@NS<x('ӆIݎ-[=#~>قΑqH`-N+̌;~'9:K#U9 Μ9<~zrUp:_I?aMyTH;ou&~v`aݧ NJk*hoњ^ח#L߄{:2&̃G_&X/ dEn͆u]ąy!LH:..&fn%Y;ۋ_ZֲӈzG~]Jm%]%K49ƒ;&a>33^/.M׈C}xm\Wާ=K*9e랁&06E3٭֋tuL ||ݷlwo[΄(J9& T~uGvwqGxG~ّ y(nR.z]4zK~{8|$}_ ~⽣~7M~I~]Ò~r}|H~m|~\.BJR8c$<'^ )ybeҜ@3lX|D>l Ӄ[D6I튷c7ى_=#}c D1,Ҏh?y<{1މk/ZsIE'@7_ӆ#q mv#%4zKjYH?6I #E ŕ 3{ɏxוRi'-6XҊ1G*R6}ō#U LjF_i]9)b!.x rhRǘ`X;Grh6Rv#/ 6>ը-ݤwg{oWk᚛Fc5h#]Fg<ȳovڧof$VFN}5S"х-m߉/ggmu6eӊ婢VNfEʇɡ4D "Җ`oױwIJH?aՎE tve3U~4E_14"~S͡uuUvsܛRwawx3uWyfozVJzE{3$| dJ} nfN}y^}œvv}.~t֕~belM~Un'D܏,n3s / NJoq柉X$|67sɔ胸dTKD>'3Ӄ' Ƀ ?pǍ؛! rՔ=c SSC2Cn׋% 3DŽխ6󞒛0aܘd qۓb̑=S9nC {2Rx u_Μ\͚]ʕp=a )RXB1,rʌ Ҫy:xЍ~ٕ!'p ٙa7Q莑B12+ F@ 56\}Ѣio1B`wL>QH5fA51XKmZ ;E{$ڋ|䔑 nH>\_P➀Aޛ0똙H9I jeٸ[|]mz^P@j0'ؔ ŔOˉ֖{J2lԑղW^eOa@FXw0jW" ESuyFva>w@{xmx^1yOayz?{.|7}jݥ~}}Oc}zJ}l.Y~ ]{~qN~?IN.% ᧏+᠙yckP*\ӃN&>.T| FPދɣL۟ x܉j~V\?8Mw>$. G 4ۄiUPÑڅҟb_wLir[eL۔ E=I-ŏNՉ o蚱[ϞvћݔhИZɖ6LB=; -) ى['v{YhZ)͕K%<א-BArK %HܞV[R{u+)KgVBnYpK4Ř7K,:ʜY ;cKuvfxw+rwdvxVٞyHRz9ϘM{*|}DI|֌ |~}q<}acQ}V<~5H"~9n<)$À{G}קǃpwcU+G邢9₾)D,6_4|oiDbdU G+P8HD)63x=0z|n֍a]ToF8d)VAG%΋Gt]{B n _9`⑜S֛}$F0?8,)&bWte1҅ zmr`bwSR Eŗ͒7S(ې`iRÓu6b:yjAlO_RŚ[ERe'7dIU(̑arqΉY@~ک$x٥$kSZ_šXR&LDЗ7(El dž&x ak1^c~:Q D\(6(]e 񛎛P1$Nݎ/M,{oi{c6WK>112$6+ X;݉ӅQ8c{ anBzbݮVVJ>W1F$"ӘnD qo3nw9wQwkax_[y)SfVyGqz:{-|}Kŀ`}vػ}j}^~S{~kG%~:k-Ǡ%𑙂GmvEjs`^< RFߨ7:-i Zk/J恌\u9i$^;qRr凋Fp:V>-Y'q4ᐹu;iwrO]ɯR1#FQP:-kBQɘj``t¹Qhⓧ]H$QEp9ݡَr-L I'ar+tLhe\ٮQ=E9D@-2Fg X}F֌r^s˸hf\f$P٩EZ9pO- *7+~s>g[魱APnE97<,- %Yr[~e°Frcg2[{OPD9О,曹 ,ٕ{o$}߼lXrHf["tOĨWsDƦ8ܟx,ԛ\ 2r0ۊwDxlGŬy`*yYUyJz?h{3׫|p't}t~ S%? 8w>~lĭ~`/~~U~Jb~?KQ3Ū'iĢ Ђ?w;8kð:`r:UZLJJ.?873u't⡤ 읠8 ڂv>ks°`4>U>*J<χ?1H3 'C ,aIvsk'ޏp_hU%J ?R3'ģ%U x͏vk͖j6_TmI۬E3R'ˢ׎7Y [Hv B|j/_b$TaΖI>r43u8'ТTꎾ9f#-u¢CjU _T7IC>ԗZ3c%'ڡm#% niu`Gj/^к kS̴Ih>\>3Vc'ǖmH̗ЊXՃuҮi*^S$HѮ碟>:C3Kޝ ':Ғ1)Xtjwi|Ȱ^T5=SV,H?>V3Bs(Ț1V6IȋybtPyuz_v֯zwA{bxDdx^y4pYz8[zՄ F{\/{ F{GSt$uv/w4`w&xo)yiZzQEz$/hz0 z[sӜJt™0uN v[w(wn xYyiE&y.zMyʇ_߰s1<̩t˹ttuGv]w`m x)Yx;Dyy.y%y},r 8sѸBtdHu+gv|vۜxl*wXgxjDy.TyCDxMܽr+sstWBu~zvjkSw:lWwpCx.xД^x`qwrԾ(stc9u7}rv j~vդ6W&wC3xG-xaLuw%(qBrnjgsjatRt|uiv5Vw,Bw-xw@ qDrq(ts9Zsâ=t%{u~i/v8YV9vު9Bwf-wvstиuugvՓ`w[ylpzXzC{-|} ڷ~/}cȴ~'}~$}~+}k~=~1~~S~kd~}~W~%C ~i,~~|ƻ|҆<|S} }7y}W}dj;}V}RB>~,e~/~ d{<{܎{9|َ||Q||i'|݈U}+{A}i+}~}Pz˙={FV{6 <{S{z{.h|6qT|@|̊A+|݉|gzzU˯z՝zzcy{Qg {sT |(@X|F+:|I{Ոy0z*Yz+yڌxqqqx6x :xy&uCyn cty1Q@z >rz<*5z3=y;r;sЭtHvwxtxNfyfSzn?'{i)t|&w} <{Խ(|(|v]|}#w>~}d5~R~{>b~)1LfQqRƃVv(vcہfQ?=a(C ʊ܍͹OƁҋRq"A!&t׈Ab䀬gPR=p(KF[1ȯ̸}ǧ3ΖpAs0a 3O<׉'/95Nq𥨀D&`r'` Nt ;PC'#a~sőݨm*Pϓlhq1`'N*M;~ّ'~~}ʉ& C;~p~Ş[_a~M~;#~h'H~}:HqG%~{~o~az^~DrL~,:}e'}*|]ƀcנ0~~No ~ ]}&L|}ѡ:d}&}1^|]mxQР~i~Za~~ nj}ȱU]y}L}:}O&|#| {Ïqys *,tFu_vpw_axM>\y:Uz%^{ T} zLzd{h{ŀK|Do|^KI}WL]}9~Q%:~ ƋL0܊ܟljk2~ nyE]RK߁9F$ہ *ҾJQ*]$(}؆Rmv\t׆kJބ980$6 Ԃtʼ{NÈke֌φv*|lha[>J*8$e4ǫ@Zpw{q#kYdZI{#7r$/ꋬ;݇swIp7+o0My=zejoYMoH䂱79 %$[j,6#ᨡ6 1yeGimY0WHQGz6Ӂ#πۑڶ붜mβmυ@xi*h*XXtGB6h3f#gχwXΖυx)rhwgبW҂/yvXzɐz=zwQ{g|0W|FZ}R4O}!D~ 1X J:|HOvx|fVÉԁ#E+4sE! tʢM%ƍOurfb U*E` 4  T ̃G{~ lt\VeNj3U3D‡v3k& I O{ڂSsAdHATfD$35݋ 2 -(XUΎj"@|rK!cGؕSSC2ۅai q^ coU Q[ ŀ7q]bvsSACN2|L Iؐw ҈вf,ǧTpleaTRRB2] a N%yܶ%~DYoB`ǦIQpBf12o ׀ሮlܚ![}Gnް`XoQ6OA"z1l띆ǂ| Gp?QrCs4tpdrua}uw;Q⏠x`Ayy0zU{}訾xӚ˙Ayz }픘zo={A`}{Q|@3}10}:,~ .΀T;<׀|“n6À_PO@j/%"] Uׁ˙C^Ê-{vmK^Ǐ-Ov?߄/nxn Y1ZzDslUa^]aNf?bJ/ڇ ;%2=yƒbk\]:N@`>ۊČf.ĉFh) ,\=YbʝxxWWjs'\]M>fON.zŎчE l ȗ,NwXuw|i[?%M =q.)Pq 1ƗD5΄ԨuvhՎZ㞤Li+=k-͇ew\ ЃrPڗ+YtubhqZ>bKڊڠ<0-{gr i XϻOdu=+g{5`YURKgm<-9CV) }p桦r&usuutgș"uY֖wK*=xF;Βyk+dz${~tңx\yRytz8fӘAzY{J}o|V;QQ}+O})~؀Y~Îlށ)seqX?8Ij:+́-mFLφ#%r.e'*WLIO :yD*ێ 91%7q"&s;hqØIdS\VӓHp: V*x4T <%~pӘc~V,-H$9ʋ*\ۋ5.aVA;}/RpbǕU~Gv9=Q*$R7ӌ_ەݟZ(塾|Lo37hb TޒRG }8֍㓚)ؒ-6K🸫ڈ6{_nX增aHaT3FZ8c~ )iC ](_mzrm`S~FZ~7(q)M ; FE\N=yAlj`ܫS#e:E7)ߐ h\Rp߅ةBry5sLlNGtq_[uRXvDx16syb&]z{~Hx1xxSy7kyRy^(zQ{_D6|"5ŕ|&s}%~h7"اF.wZ:jtF]S}QKCq5uӀl&|HƋ(1rvy.i柨]:rP@C# 5+"&`fń}"O#Ō"uQ%i1\mOB4ؓ}&&kщaPـ;˘tVg[B4Nҗ鑤A˕)48f%90]"DӋzgoQs?fqZ}JNK|KA]k3%mEf~,rm4f6A]Y!Mb@?%39%} (ۧ;}ͣqle}Y`ԣM2Ƞ@q*3,,%D\rφHG}$q:ZeX䙖dLȖE@2%A8 2b*q[zrosbtVԤvJdwX=x0,y!zڗ|YwvXx7zOxnvywb`z VKzJ-{=f4|[//}.!~^T8~ym2aȦ?Uɣ6{I=a*/řW!́;TrOSE[xĭAm̈́a7UJcEIR"</!Ztrr&^Dx%pl``GT Hޞ-w؋ǯ]uG_i?M^.ZRbG*I;Ҙh.}h!BQ0bPEYBtZi+m]xR)^FПf:s.C?!%8^k gbztٱh]3YQǟbFc:y'.!ܖYi3s{Wrp?sBe t`Y|u]NZLvB@w6}x*@z1y{l <1}8${ uxo﷑yӚRPg΂MyiniƊc]*,X;߉aMAI6:)phgz<όۂx葿mݴbʯeW9.L2A\58)ݛ?htz2uzv{'1wR{Qx|Mlx|X4y}PCzZ}-ez~ z~-qԃ s-t;£9u(iv1}wjwW5xByvl,y6ycpm9+qr󊦡s2t|uivVKw߅B!x,[yiyweoSRp3q𒩠sōt{wu,lhv2Unw&TAzw+xXxZԳntQ«ooq3rQrspzKt7guTv@w_+wCwm©(o79>p@qNJrٜ!yFsfuSv9@hvݐ+_w1 wђm9dnpq).rTxLszft\SQu?va+#vO*vUclؽnD!o=poqwTs\e;tRu?u*v:oCv$IlڽkmDo:pWG q v|rdsR9t?Buy*uԘXuˍHlLмzmʌnYp B[q0XurQ~csbQtYB?u!*uhuґ|(ngU|;p|\q|s%|ty}ug<}RwST }x@}y*M~6zV~{AЊz#xWz|xЭzy|9{(zj{zx{{zf |A|#S ||?J}}U)}J}Z}~$]x|Mxfyq6y zWw:zʀd{IR {ʀ>|7)X|p]|Yw0ǻpwɉŪ]xVљ xӇyX.v yކwczoQKz#={s({_{ʁv#vϒ7wkwCxwtybyP}zKo=Xzň@(zZz{JuV!v 0v*w>wؓsxubyOy~0֠~%-~\~o~?]~;L~aQ9~}%f~}$~}Kj}F}D}F~p}Rn}`\}K]}9}Շ% }džO}Äν|x#`||׍i|}8|l|\|PJ}$8}@C$}^}{ۢ{ :{6:{t|)|l|4k[M|jJ |8'|$||[T>{^{f5{o{yT{%{ k!{Z{Ix|*M7|B${|{Ήzyz{{ z${$j?{@Y{yjH{7X{ʗ?$G{J{Vz`zz|zyEzī|i{zݧ#Y.{He{M7{ab${v z-zưrzqzaAzakxzubhzjXzGz+6{ #zė3!z;l͈nWp]tq{n8s\kKtZzvIIjw6x"~y Pk{")u Mv}wvx4zy j}yYxzH6{6-.|U">| ~U~*L~UK~y~xτ~iXFG|5i"4 ܁gz߆G2w/g1WRFӂ58?!ҁz" m݄$qsvzkefkVځxF)\4Á!†o O2[o͗eO̓BuTϐ/ecVE̋4Qzv!l h%1T?:Ã}ItVDeޓUJDM3!Au ~!BXk8sa̛dCh0TDcؔ 3{!~鏩 ~)up2`q[ӥrleUcmSCg3!A ~i }ˬF/-ˁ&4pqbSCRCR2~ } }Gޫ2cngϸ;pǯbXRB~{2{~K } 4|&ldyn-oۂ qbr\rcҊ%twSuC\$w@1bxr'y {۫ᏒtԎ%u{v|w{qƊPxcb‰2yWS 1z}}`hp}pY}aňM~AR:]~B~1R9f ̈́b#ښ߄&~4osr`هr=QyAʂ0ą" H@DB Nۊ|n_醼FP~@$0cp4 `~ Ɨh=@{ψ mr!^-DOX@Q/։߃*` V–ښ݈mzȇ8l2^0COEݐi?΄/Od* ԀɕiĈGQyɇ%k,]j>sNl?J/Lґ: `qDԔbuxȆȣ+jˠ \ڝM>8|.^7jo '߇ي Wӱmw{izR[M]]>AۜR.? FvˉĽs\j$w3;iV8[i?Lc=݂.>A `!l.iDn֔"oxВDqRjr\fthMcVu=w7-xJy"|tu@vMw)w)ix[{yLrz =&z,Ŋ{J|n&~{|E@|v&|h}`Z}K~=_nk~ qd+m5VÉHLj:@m+ 5  -z55u}@pcX V YH+C9*=脑x ZS.±SѮ|čoÌ@dbUn@G9O+*[[/Ƅ ~k=|\| ob v?TG4*8X * [ .ѠCl-]xm|oogq*bNrTtGFՑu7.w"(5x|y&G}*s0/t{unNvakwT2xF:y7Ez({3|=*z{zt{mP|U`'|Sx}SE&}7-p~\'ۍ ~RRڑ휩Ě&y`li_IR8EZ6э'E1m``Ή`MxRCk^蒎R D 6l'}ӏzwQO\j˔$^QYC46fo'FމڈF Ď*vsʔvj]kv*PrC|X52'HzO񍞚>uZi8y\mP&~B%5Ag,&҉mf]Ekt4ha[ OBnr4Ί&Ij؎х;՗sԔgb[RHN? Aaq4h&7╭R[_WޙGpڲs+vg ZːN~Ai4O4%? mO6lB~mro}fspZrM7t$@eu2_w #expy%}EsS}tZq֠u\evXYewfM8x?y2z#Y{7p|y2zP|zp㟚{Edܜ{X|=LwK|?}s1ؒ~#N~sMw ${od ΁XKޖo;?_1#EL؉@m'ψzч{ocB bWNUKG>P_1N&-#,KJюK/7ZDyˠ(n:CbjVJ>&b0#S|qÄUx maۙߑV1J8}=’/a0" }s݆k*_x!3hlEsa,fUxI=V0eui"_!‹*#ڣCwDڠk䞦`lMTϖM I%<ܑH60"t UpH_vxk+_˜CT:HTKqx%Mbm} bŢ"W򞶠5MB6g6Õ*Ȓ*rHgw[lZubI֨WcL0UA6,*ilȔntmTiy+n^֯pLTqIG#s>jt2١2v&&Xw+Ix ̙+{Sޏ;~sRsi t^yuSvHw>-xx2!y&.z_| 7~irzhz^{S[{H|=u|2}|&~NE hw GrW?gÀc]{RπHR=l2h=&j BP!qƴ%rgk݆*]ŅRztG77=_285&w3%ח :.q=Z\f߯ \wQ=7G= ׉2z&ff P!9pKfU>\r"QG,<ş:1՛׌t&W-  Œ yhYp,Leέ[_Q' FϢSu<{L1C`&A/; 5Èo}beHq[\P}FkǗQ<*#1g& ; un4dʬZnPM@FOQ;❰12D&Y <Ո6nk̫0d\Z;OE̠b;R1䛨%ꖞr TS_Ahnn^xo{TYcpJWq@WsP6OZt+v[ >?wy9|@%hz=tq^\uTI6uJHv@Niw6N;x+Yy j{$\|h=1~LW4h9zd^%szTzJ*{Z@S׀.IxB@%y6;+Ĥ7  Z5x+!KVӘЍ +B eq~[8RtH^ 6>ͧȚ5R*+p!$ ɑK<ł0e9P[}Q-H.>R254$+a_!8F feh`Nrj3.s%l5Vt#n#bu oJuqzvs[gzwtTaxv@vyww*yxfzyoѾotK*puH|r/v@sPw0thx"xuzyfPvyS_wz?xd{* x|fy|`m~o#~"p~8q~_Is~wt6~ewfI)wNgxE|k݇%mêo gpqlqńvPsjd:tRQuu>Dv}))vgẃ~j OlJrmo^pƋQu!r$c9svPt=u(v'w8i^kdminsx(tOgu@jgyiikȒln2q$o_qN6rg;so's̓xtԋ)Zg6hjl--m}p\o8_ApbMq ;rP's\7t{yfɓhj:Nkȸ؀gmUonծ8^pDMXq2;Kr6'sKt4Ux=i^xkty mzyoezq.szra{tOR{v&<|$w&|x }Hy5vrvt>wEu2PwvAPxwMr9y-x\`yy^NczzU;g{{5&{x{ |?|ut|Rt|hu|Ԓvz}w=}sqw}_x~-My~:z,~&'z~){V,r_s}աtbZ8uCvovN^w̓Lx:2yPs%y(CzqRurS'sMt>Vu*nv]vLwه9x+%x҅lyÃ̾np]nqm^rtobsn~tfmuXW\vMKPw3H9&w%Kxy ؼoXp1q/r} s*lt\uJv8wY%w~uxoynKpq r|skt[Au$Jv8Pvϑ$v폥w:nrOoxep~q{r ksZt Iu7vI$vfvwx2mynopq /z"rj>sYt#Iu7uԚC$u/wD$mѨno1pynqirYas&Ht7Xuu$fuEvҊSa~hŬ~jV~lD~n} ~pl~rr[~t$J ~u7w:##NxH yh|qī#|s |t;|uR{}vrkl}CwZ}xI4}y6~z"~H{k ~|Uzz){!{{Z{n{{z@{|RjG|#|Y|}}XHq|}6t}1~P"}Y~ }y{ayyу=z(ˈzy z؂Qi;{-,X{G|5|`"[| 9}"MxSx y &]y.wyVh1zSWz̆G{F5{~"#{ p|^f wQIwϒLxGRxvy+?g0yWzFhzE5z,!z {Sv(w ԔwxFux}*fQxVZy3Ezj4zm!zU zMuvl̒v߃watwAexxaUxEFy4?y䐽!y zra u^nu鑱v\tv٣sw[dwٝhTxpODyn3y^!cy4R $yuYu}&u)vh&rvqXӁ1bl0R0B218C Xrޛ{Q*K/m~ p5~ap~Ն`R ~؅B ~>1N~~ ~Ń~~y~dP}~Ko~9`}~({Q>~3WAl~DG0~>d} ~٦}֚5}Ø9}<|};n,}__}P}@}O0}d}Q }Xg0}Hmz}/ۉ}G{}mC} =^}O}@[}10'}";| 5|ɇ|۪O||z|llY|j^|{O7|?|/| |' Z|P|C|`y|Fy|6Jk|0]f|)>N|8?V|E/j|*{ x{|2`|v{[x{8j{߫\{էN*{9>{럗/"{˚{J {Ѥg)i߉kRk{?Qml`o^fyqO$sQ?,t.UvwCwSMzppqn ryskÇ*u*]idvpNTw> x-y>zƃ]|Ljwtxy_xyj z\x[{TM|><|-}J:},=2jwi%[WHLփӀf=f-^6̀π ֑:UمxvQdž/h#ZEL <򂩄r- K*%7Ӂʜ0|owcu/7gu,Y‚ߊ1K]l>~7=}r7}f|l~5Z<~M~@͌=3H$tGAtff}GDqyMeYiՃM-)w@BY2K$MvolWb|p~dՉLX(L?u2Oև$F@Lk{ݑIoc6WK?A1A#b'|Jc}zUnȐg6c+tWQ K^r@>NJ1#zki<7Py)瞟mߏb\4cVNJĊQ>Cx1+?#]ŌmWXXxGymaРoU.J>=ω,P0ȇ֗#`9<tu(_w/illHva~U~ܣIҊF=pڞ#0xn"ن$iȍ1ZzgwSilk`2myTǘo\H_qB<$Js.t\v3w6|]nvo pkG_qp_ƙrTt*HW:u;-v.Znx.+yntz~~UIuuivhjW4w?^x SnpxGƔ(y;S%z.%i{ |Ž`}:-W|3t^|ic|^"}BRi}G+#~/:,~-|( %G_~!Zsbh|-]WւRFK:wY- B91H˂};yr gqq\Q_؇\F :-cbs\%]|L֐SqE;f̎([xPӓ<(E L9-#Uʋz>!&{bOpٙwf0=[U}P@E9C,Ռȍ!sNzPzםoBe]ÚZg*O1dD8Ύ7,uI\tybo,آZd]*YOśD8g,ޕ x(#HyxΚny}d PYpNmHCI8YU+֋qkwyigljbUwkW{pmL~oAfqj5vRs+(LtߕvV xw5} vnlA`pa!qyV2rK\t'@u51+v(xA y {t~uҨwu3kxv$`wVMwK{Ax@y4z({-n| iA~Z.tT{j|`:|U|J5}a@v}4~y(pM] b3ztY iԣ _ TJ^P ?*4Q-R(L]_% ɈHsRxZi>^֟-xTiZIܙ?@߆Y4v'(!O$`y :Ӆ&[!r~ˎho^BS盳Il+>C~3։'aj jކuVq7g]US^ H_>3qE'ʑ rR `傄qg x\d RǚhHtӔ>,3T'|#.eO C3TpT/fc\aRAH[ =[2ɒL'J9 < : ݂oWe̟[圐QՙUG7=h\<2'v ?E}lhobjWXl*Nl8mD+o9աq.sH"Μ{t vpy0}l#nb,)p$X0gq{NrCݣt9uu.v"ݛ'xQy |MTsktauW.vMwCx9[Ry.}oz"{D| {~׋lajͯ{a{W%|%M,|C$j}9-}.VM~S"  ڒfJj*H`l`VqLŁvB x8ǝ8.+V"΂ƃ6 /1(i2_VJLE0Bc8~u-"ٔ' { jh_`-RUKJB=8>ˉ-ؘ܉p"ۖ1vވ <kсhcH^ۨU>K~Ab7--:K"ɕ  .d!g뫮^Y}TO"KA]“t7]-q" ^ g|g[]٧Z9TLěJlA 8S7g-> g"W Ŏ .fê&]cSTJ]@Ŝȝ57/R-"q蔻H D=F7a_iGW¸RjN56l?D9m;EQo1qz'@sEwtbxvјz~a-oGWpANqUDr;3 s1KuY'vxLϞyX |`ܹu)WQuMױvpDuwG;x<1 yG'zj柤{/;}ϕ![`oN{VM{QMY{D9x|":쨖|1}`'U~Z~9nK3`MVBMCICm:1c'<72lؚ3~_efVLZLcCJ:/1`Ӆ4'Sb[0(qtU!ɀ_gVL@Cyɉ:Y;1D'zQlqJ x_uU/LrڏC=#:(0l1#]'ό&ˆA0^UgxL&B@9s0/'uÎ˖H[[^YTUXKjBç9£Ζ0Ӡ}'y 5,~^BTѮŠKߞBl9I0'i6f *!^ȁ ne og pirl(s7n;sGt\pBa|ur0O-vt<wu&xv ywxƹk^nmpx2nq;psQ+qxtrru`ctw+NHgŠ;i؉Ck\/m^no ]~pKr<9vsI%Jsuւtd6wfxhҐCjP}l{mn8W\oފK%q\8rN%rUWu'3cA.e#g蘟 iՖL|klm}[o.Jp8q$r1tb}d壉glif{jklҗ[nIp^85qJ $q@t2ua߯媧d@fx\hozjX)jl2ZjmSI|o'7pN$qDsfaDceWgziͧj)kYmkIn7p;$}psN/`Jc0EeyO:gnoyii[ik8Y^l@Hn7fo՜u$ep&+sAt1dK#uf2ui`vk}wAmm wo[xqJOys7z?uc#Azv ~|wqmì+rojjspMtrz|uskv{uGZwivIqxPw7)yx"yry { zoav/pwɚqxs yCztyjuzYv,{`Hw-|6x|"xS| z}lmQopqQqyr̀isYu)Gv'36w4"RwM yB۵l䦓m*\o,vptxKq.hr셓X/t#G@uDo5v("val 0x{$jᑨl4n*Άo|w pЌ7grWWs\Ft5#uk!u vwƄ "{rsCutu9qvkb7w%ZRwB{x1yD<yR e{ة+q7rs~tpuaEvSQw)Aw1'xx~e zFѧpǗkqs}s ot\`suQ0vz0AWwL0wwĉ yup Ҙq3jrA|s)n(tN_tPuّ@v0vwDUbw yFoKpXqc{rjmCsv^tVOuC@Xv0!v@v Fx0o͖pTq zr Sl}r^;sӟOYtF?uK/v1r!u> jxN@nWoQpHyq~#z..~I{~T|!~}v{j|xV{|݆|}4x|A}uj|q}\|~M|~m>2},~-}a~}}[%p~zzfgzw{'i{hw[{8L{=|R-|g|mq}Svx㌊[yzyvzDhz Zz߈q={-"{̆M{ |nwxyuy{gy׎Zz/:Kz{p|Tch|VD}k~_ }?RG}і D}6}("}W}|}s}̨*}ڦRw0}ѣj}^c} Q}eoD`}K6p}&'|֓|\4|}т[}v}xyjQ}N9]}/QH} C|6|Ś'|mPn{R|[mb exThkjO^׊}l}Q؉wnCp5Wr%t1uQ;yΎݍ]j),lw!nvjp ]܉!qP9sDCRqt4v8%aw؆xq]2|Hr(su܉tiu\vP3 wBUx4y%mRzb{˃H~Cyp?z_tN{hww{{\|Oo|B!C}4$}%K^~%$K~,zҊ*8s3Ngpk<[@NOA\V3c%}8><)}rhSzfxZDgM.@3L)'$ڂ?@Ԁڃe|KqteٌY.MN@k2삄$uEd=)`{Xpd҄7PX҃LZ?k2$f^@gSG֝z=o\ddYX! _Lmv?l咨2a$Ə.NhbYz3nكcT9sWK>ts1Àꕄ#؀D`_~y@F-n7hbłۤW =K7>H1x9#ڔ ~ꍎ~Xdcz@enۓ$gc{j*WlYJjn=ٍ%p/"r^!t ׋uf_HzjCy(l3mڑnb$oV=qIJ5%r=Rt/u!KwS)x߆5|Pqbwؑrl"ta4uUnKv8Iwb<ъx}/\y )z\{RA~sxxrvUy=ky`AtzT{-H؊{zC 9\ݔ.ޓ#܌iB  fhS_dU+LnȜB͒9qn.r9#ŏ` '2 )eS}c\eRhHj&?0lB5Wnf*bphrC\s{w&}#di[XkR'm[H$n>ߠ;p5lr\*t6uw/z~Ud &oZqPQrHs>u 4ݜ"vX*uwFxKz:x} dcjuZIvQ swGx>"y4zl*Op{XOc|M=}]9<W;b| Yh|PV}G0z}=Ŝ}4O~*,]VCxGCbYpPf)Fʞ-=rH4v* v[H,aqXkO#FqÆ=*3ܘ0])𕮆X_oّ!؋pG`ٍgX)ȌO@ь2F|<ޚ93zn)͔#X f (`n!>WaNɟvEBt<3a͎)GOD4ۊr 5W:P_z.W1lN`tEYsרNx 6 x-<|y#z| G}3t&XQ{xP{GX|1>"|5ᣳ}A-&O}#ʝJ~r}<Xi`#5Z-W#ԜE(뙑eWق@4+X(4pOFܨ>.Fn5]-m#ݛcA8hdWծIO: F_=l5l,蝴R#ܚZ2 產9܆WpGN4?FSS=5<;,Ɯ퍐#Йƍ8DՋ <)WŖNvpF$>=˓@5v,A#Ù~P8LKVANDךEޥ=^.4,{#YTO osP>j _kbӝmSewnhJ} p#jl{qm[|roZItAq~7u\si#ut Ixufihkjmlo]{n&qkForZsqStKIru6sw"t_w ewmxd's@ftEhuNEjv\zFl[wXj'n#xNYoy4HGqmz 6Arz"?s{ vk{a|adj|vf|h}1y j}~il}Xn~ Gp4~D5q~i!q~U u~P`~Dbe,sg^wiyhkTWmnFo&59pz+!p tγ^}aRLiB~k;p&lbaWngQpAqv1rE~r qvAcߔ]jbO!lğ?n[F/od$ok( |tqĨv`^暡vavwnd}wgo5xi`Uy$lmPyn@`zp/.{r{ssT}av]ssgǘtPiu)k|bummvo_(wqOxVs>?y%t.yvPz w$|NyNq pwr)qĉs:s zt6tDlu#uu^vvNvw?wx.PxyxzO{[{o xEpRyqz/yrzk{s{M]*t{N"u|k>qv|-w}Wmw}y0z~7mPfn[/pKxhqK2jdrr$\=sM`t=u-vVv~|yeUk؉0mqn1w9p0}i[ql[Zr9Lsх=Pt -=uEu>yijlPjm܏v3o4hupZqɋNLs $n\,goTYq KorR}vpvcYwsUxGxǀ92yl,)y݀; yD{7r-s|7tZokubXv{`U"w0G8w섂8x)YyxQ{BqÏ~r{snmtЋayuTcvdFw*87wׇ)x>Kwzpݖۆ]r Hzsmt`tmSuFv{g7w* (ww%Rztp.Zq]yrpls\i_t=MSus끱wŁ4fkց hxjkl_nRp}DFrG5s&0ulEvHez nHA,ow9r0is!ɄIu@ZvMz˄Jm_yąon,pb߄r V9ssJ؃t=qv10J/wq! x҂yk_|ӃXtxumnva2wVxJ%uy=l6zY/ { !{|~ | wQ|lRC}`}hU@}IpW~/<)~/ ~!|9">Rԁv(v$k@4 _TnHu*:+f-n t_jxR`8,VdKאA:1a5΂;)Wсvo)sJ/i^_7Uڃ헇KmK@܂D5)uXێot퉙!riݡ$_r0$UjuKٛ @C5?>)A]txyB~͂rҙk^sia8^cTfdJ1h?;kg3jLm&_oǎqw szqNe;h~gl^.iSݒ/kIWm>o3 qv&s/zt x]w|pwkgm]85o-SpH$r=> s2|uE&dv w Ɉz"}orf;s\ItR>9uGv=dx2I?y&=Wz({ |U,ng^y&ey[pbzpQ{GS{=B|g1'}&B}3~Y Pŀmmd+ZLP܌*Fȋd~RT~I 0?P6 +ێM یՋ ^c2ZQДH7?Jo5َ+) ̋Մ8n A dbZ QK)WH6`>s5+|e ه n:a4YtDPcGÐ>B5I7+E Hj v|Fa]w>X瓕FPEAG_&>@?5 -+T qOe 膇 e`ÔʜqXkO2G`)=4֌"*튚 W 凼 l6^D^U_5a{LXdCqfi:47h0؛kF&mhwoN]q ve|]p7dTߤAgLi7C k,9ޜm-01o2&6qrtzx}\VkT1lKncBo9q0\s#>/v<w܍{x~\pSrRJusBt9u0Yw)&D\x\y0Vz2N}[XTvRwJn(xAy8ǘtzZ/Ԗ&{2&)&| |p~(?Z!|Rk}@J }AM~,8k~/"#&ϑb_(؊:'ZZQI@͂8A/{A&6FߐjᎣ0݀^Y QI?/@Z8$/No%a叆4VEЄ9Y%/QPHәS@U<7֋/_%Ґގi XhPHt@ N7a.% ֍.+:>XRP:UH(?˕7O.ȑo%[3ύ^D`S*7_&JapBc:%f1hu)j\m+;o: "Lr 㒐wPE}ReJfBeh9j1l( npr Uu*Zy~R!jJK1l9BCm9UoB1[[p(trȜt7ěu 䗑xDÏ| QopIکqAr9ss1+u1(؝vxϛuwty 3{U<~WQnvIv:vAh]w99{x1ys(ɜzd{f2|} ~=} Q8{I:{A-.|g9 W|0q}(›~4~s 3ڋxЀPH@'8X<0ϝy( s( -)PJH@*8a0( Ӕ, jl! UP1H^@{/8~fB0 (ъ  _FȀ/OťϐH &@=Us8N0cʎ|(~ L S`ËK Ï"|ЈvUPOdTGĢ[@ 8'ړX0E!(jk , pd:jkeZڣg^iCaLjdculg3eneiUplDqn3rq 5s0rw wtbdxdBfǒf]ihhk`tjemydlUo~Tn4qiCos52qDtqru qv.*rx YrxwzRbu]Sdv:fwyhwkbjx]lyMnz\>Fp%{ -q]{-qR{w |ա3`~ b~1e~]xUg6~jJiJ~\kQ~M9m>=n4-fp3Dp)%u-cgfIYhQK\jpwkkmm'nenslopneq%qXrlsIsu:Stvb*=uwux"*zCzi.sMjt]l^ur3mvdolwW2pxHrHy9szc)t{t{Ooye|Ig)|h|{~j|qlW}/cm}VTo}H'q ~,9Lro~n)sj~s~xew)Ng]|i:ok ]blÃ"UnnG|p8qrn)[rk9r'w%]c%fA{g`niމakTmwFo 8apc)qqɅVzwN/b̔$dzf~yuubL;udyvg0lw;i_wkRxmDy[o6zq&xzslztqU}bxKrSjvsSl5x,tMmku=o^v"qL{}Jm{?D}o1A}q|"D~s&~t%|xֆ1y}iwzykPoz`mcznW{ApK{r9>|s0|ruG",|v}1wM^~{wFqywr^nxnsbytWyuJzw>&zx0{#y"{zyF{zn}}qugxx{vyQmVvyawzV(x*{8JBx{=yl|e04y|!zU}Thz} | sw-t l%u+`vQEU@waI~wxz.}orp,3h1qL]tr_R]sdHG tV; u.Ou u8vՋ~yYt]i{`K^vc0RfG|h:]TkS,Smo kq<0wR}aLsWchAfr]ShQkFEmJ9o`,aqKr tay|Thq]jgG@l\G}_{8B}{+}|W~|X~U}~Bx{~n}{>~sd'{w~Y{ N|NC|P7|+4|ۀ|S}}X6~6wymuyc@zRXzqM{7C{a7R{*{| |1}IvfxlxTbqyVXyЉMcz7EBz6z*{1o{4?{ąa}upwƒkxaxWyyLyyB&y⍁6z>p*dzy]zm{ Q|twjwevaw֗VxZ~LxxړAyPm6Xy*,yݏ;yÍmz2|)svQj[vɞ`wGVwΛL"xX!Axٗ;6y4m)y^X y9z)W{ڂu?YkA]a`6VcKe@Xh4k/'mpo] qxCsߊ5`jFc` yfUhbJ>j@ l448o'zqr ԅ,tzar{ghӇ5i^톏kT mJo?e qV3s'Ftu w|@q,ngGpQ]qS΄QsI_tq>ʃu3WIv'$x̃"y$ ^zT}p%ufv]"wRx{HyY>8;z:2 {&߁{΁|s k}zo0|Me)|\!}MR;}H b~!=#~2~&RÀ ˀj}n)>d܀[^QG{_=?,24&n؃- abm1&wd ZP)F|<WB1E&;2~} ~΄~ЁlYEcI OZ~ݎPx~ʍF~<~1~1&~s~' .~$w~Tk~}b~NYz~+rP~2F5~<=~ 1h}%}Ўy}s >} }j}˝Kb}Y })O}E}<}c19}%}Lf| L}&P3}*kCYa㒧]Xw)`NbDe:lghz/j"m2 :ozr^yj``?c%WeMgCjH9ߋl.n"ZpTbrRQuq}{Qhڏg8_Gi5Vk&M%mCQn9S p.\Lr"t"uyx,|gm^݌^oAUƋNpLV^r+Bss8ˆu-v^"bfwW0]'0WNo$ oSVZ-Nҡ=]"F_=b5?eu,]h/"$jOl oit|(Vbh`>NUbFe=gl4嘭i,"l"vCnAՔUp; {r^w}xUEmj7=l"4n +o"_qs 0uNz '~TJlLmDٙo[<.p4"Rrl+s">unv rx|GT(qLT|sA:l݊3+$afl+YÏ }, HkKA_/:=S2+͎$UpmێB !xajUcY.e]I|}g`mimc^kQfO5m.i?(nl.:p*np=pEvr%]-_n_bGXbRezdglIfj]hlmNAkn>`lp-nMrnjsBuuYh\j_tlyyan~kdvp9\fqMei$sx=k)t-"lv#lvntxVq Yr؆+\tx5_u2ib`vA[dwHLgmx9= iy,jyMkdzs{d SznjWlzZ{sv]{h`|KZca|Ke}ag:dotigf,jiX(lkIwnqn=:p pY)q2r,~qs$xv_ghb0i"d~krfmdho{W,jq=Hlr9|nQtm)zouZp;v\vx\p4_q~brqpdVt5cfu\VHhv|Gjw8lx|)myF;ny-v{Z6x1]7y{}Q_z&pBbkzbd{8Upg5{GBim|08okX|(l|>m|uH}{X[N |^Go)`܀ackTeFh58j,(kl]lڀrt' VRY{\n6_w=a*b%SdF#gB7i#(}jg&xlZt Tؑ;~XDz[qm\^C`qaPSjcEf&7dh6(bik^sS>zWy'Z`l]@_`ARbʐwEXeG7.gc/(UhjʼnsRRV/#xcY}k\h_C_B&R~bE d7f(MhjG-rÅQݩpUqwX£kh[^^R(a^DcL6f!(Ggi፧[r|m2UCn]YO{Vo\nBp`4`qcYSrflE@tiJ6k&Lv!n;wow{lsip^.{kaylclmf_obiRwpkuDjr#m5soo%t[quzr7zFv f#fh hx-ijkkl^m1nQnpCpUrC5qs%ru?t uyByLZc1n%egpivg|qjTias"]k2tdPluBnv4p7w%dq5xryx^{`wc.wueuxi7gyf\i}zOkfzB_m={N4.n{%.o|Gq|l5w}#^~Oa]"tZcUh-eq[hO'j Al 3m%n?pv\!_UsRbXgGdpZf܄NhAUj3}l$mbaovKlj[xw~^arfaf{cwZLeĊMg@j3:k$lo*Ou˃LZP,}*]Dq``ebxYdҐBMg@i&Q3j$knvu^qYb|]\[ p_"e+aY5dM#fN@Ohk 2j2R$k:n uX{['pS^hd`Xc^|Le@gӖ2i$jm:tsUf~tSY"ru\fu_Zv~cMmw?f ?xh1xk"&y|mzoc}~tG"o]}Mq%`qZrJc`e6sGeXtCh|Lbu;j?v4mG0woj!wq>y.rG|\wOle{nHgoojcpl Wr+mK}sSo>btuq0uvsH!vtwuv?{\yimzBko5nmkpbnrVp8svJqt=rv0+sw%!txvxz{{Ƅ>gucxivdm~kqwQam x V nxJoy=Dqdzf/r{ !{sJ{un{y}e|wg}HlZi}`k}U0m0~-IVn~ps`*t8tw(zl_viΉlkbmVX.nʇMipBqXl6rp*sJshvq,y炚vh&ljQalOdWm̍WLo2RB'pW6ql*qrytrƉuՆQywuWgEklia`ksW!lLnmAoϐ=6gp*Jqˍer#uVIytfgjh뜆`jVlGLAm˖Ao<69phF*+q<Zq{trx҃wUZlYb#y\WmV_LkLbA7Qe5wh'k yyGw3yx&zdyzz |H| }~KpՊb56e*9h:_jSl8p@yWbf\"Y(_ PՊaaGdy>)g49i)kMn oDtza8PbXeO$gfF܇i=k4^m)o;qs,6wz|t`iWkOlF!n<pY3r)GZs(|ӀT\%TȀ7L]DЂl;F2Sy(bL);7A\ ~T6~L%~C~:~P2 ~(p~|~^~>~W~ŀ[~},S~K~PCk}،:}͌1}ɋ(V}!}}yB3~,~`[} JSK}wm p0Iu|Wb'OdGƎf?Oi"6kH-ml#osGqOsXw}qVhLOj\GlL>n 6o-[q#ʼn:s(Kt9vrFz|J~VncNep Fvq>1r5tF-Ou#vZExv=y: |UctJMɉuE)v=Ɉgw5cx,y#Uzq{}~ـT#SYe4S_@R9Ki8D"<[4X,8#TqAijZOҞUHURY@P\>8_<08b8'le+T^gj? m+sZ{OR[Gٙ^@'aP8;c/蔲fz'Ci P3ksm npv>/}NaG'1d ?fd7h/j'YLlD=o:p s爈x~LMߖgkFi>k75-mM/7o'p.zrXt; v5F{ g[Mm.E,n>p6אnr.&sl&t-vEw EUz}'LurEnt->,*ut6v.ƍw&ጂx-&Ki7?z 2 2[HEmU>X7[[/s^(:Wa kfdȚgPUjn`ot|E+}[_>>*]7 `/c-(&e y h]jmeeqwwDU}Da =ßc>6et/ug(i yl$pnSAptV^yD(f=Jhw6Pj_/+l>'֗n co-qwsw{Cl<⛷m6 o>.p''rM fdsTumw9\(z}q4CqZ< r5ߘ7s.ߖfu'v\ |w@x]z}8\+Bښ?vntZxwǎIV-k4Yfmu\\ni8^p]\kaqOsdsFAfyt3uh|u$Tiv-mwHx:zZS&sVttyYuh \v[}_vwNb5xsA2dy63fy$&gzwKlhzw|ʋ.P{XT^|(sZW|g Z|Z]}3N`}w@cI}2eo}$f~ks~8{v Ne~7R[}rbUPfBY+Y\HMs_Ig@Mb2d5$eSjvLy}5PqTi eW)YLZKL^q?`ۆ2fc $dL`i鄣CukJ=|MO2pSdVpXYΎ L\?_ڋd2[b0;$;cpTJiEUtI {NYpRdQUwX_X֓LX\?_2Wai~$Yb"ht|@HzMooQcTX X #L[V?^R2T`ǒ$qb,9hPat&hDQ~iUrxk&Xfly\Yvm_Lo/cY?pf~0qia!rkumGW| rncY}e\pg_difbXMkeKlh_>[n[j0ympKzMy|ՂsWywAZ]zhk]Xz`f_{sTbu{Hd|P< g |.h} i}koS}Cx~-Tav'Xloj[k_^ULS`0H.c;e׀.g hnxÀS!u1Vuj)Z ^\8S`_GbO;cdb.cf g.mȃwN Qdt]UP|isXx^L[HR^$Gka: ;1c.We fψ{jm)KJw~MPlsT$rhW]Z=R]G'`P ; bَ.PdH f l`v}OyRsS0>hbV ]kYR:\F_:b).KdCK el= vW݁nyQuoUj\pX^q\VRr_Fsc9tf*,4uhovUkV yBm~Cs+jAY+tLk\bhmh_v]bnbVQoe"Eq+g9+rmjv+slFt6n 7wpV}wv}farhcgpj[f\'kh[PmtjDnl8p]n+Mqp"r?r; dv>s|x|Pc+hqWejfLgl[%inn_Ok-pDAlq7nus*ot{psu tvI|$zz`Wppbqe6eBs*Z2gDtLNi0ubCkvr7lwq*n*x[ny sz {p|y]wn`xd3cNy^YUeyyN@gzC i}{7kI{*l|0 mw|r}s$z~xa[2m^_cTaXcMfBh6i*YkslH!Sriz wMZnl]0b`Wbo:MdB-fc6h؄ *>jX'kHq[yvdXl6[Ɍa^Wna-Lc*AeۉO6Zg܈*0ig>jtpUy uWYkZa_]6f^=* gbi=po܈x]xtQ3muUb@vbXWjv\.LKwu_@xb4xe'yhRz)j I|mJt)vqXk~r7[`sD_VtaKtd?ugt3vj'/w~l`KxnS zp{fTvtgm^`dinb_vpWe]TqwgJri?#sl3btn1&upEvq ys~yrjghli^tmkSo mnIPpXo$>qp2rrf&ss@tZu x^v>}{qgdogi|p]{k\qS"lsHnbtQ=ou~2qv&hr wNrx} Uw@z}3} pevfg_v\ikwR[k!xGlyE=tn8y27oz&Hp{\kqh{ vD}F||~ogc}eew}\[g}Qi}Ggk>~!=l~b1nD~&-oZp:i umq{{nia@dcӃ[f$QhSFi< h1Xj%kێm5 s<dzDKn{{wQ:d|{U#Zo{XPI|\BE|S_;-|b/}#e# }hJ~pjmulwXc!xQ[Y3x^OyXaDyd:RzegD.zi"{l-[|?nF~5qxkt_au'bdXvdNvg;Cwi9x=k.xxm"yokzOqi|t8yj'qf`rXhWsyjMAtilC8uRn9v4pI.wq"Twsoyxt{wOA{hnxm_ooWV6q1pLrPr9Bs`s8tbt-uZu"6v*ww x zsz|~}lgl5tQ^muUgoGvKpwqB qxJ8)ry#-sy"'tzu{ gyu}b~6fj3z]k{Tm|.K>n|Ap<|7qp}`-Or}"sZ~Ut}~ xh}ehv]jWTl JmA/n聾7p5-$qZ"r4s|i w }'eEg7\}hSjJWl=1@m7No b-pV"q7-r wG|RdeɎ[gώ&SilJk%@l7"n8,o}\"peGqv FvDž(|Zucdʕ3[rfݔRhIj@@nkf6mzX,n̎p"ob\qc ivaR|eBQa[؂&U+RXI\)?S_u5Wb*beu'hMUj߂nwc~X9Z~[mQ~^H~aa>wd04Df)iJkm6qyvb}{1_Y{aP}|/dMG:|sf=|h4}k@)}mj&}og~qt{a;xPeXygOyjF~zk=zm3{o)<{q[ |r|tP~qw|`!ulUWvnNwaoExq2v7< vw32wx1(xOy)xz/z{g|R}|%O^JqyVryMszDt{;uz{2v=|I(v| w}ax~l{x{0S]oaUiq$MrFD_s9 ;lt!L2_t(uvU8wׁz~\nhTo…LpDqY;+r'24sޅ(tuL&v z~M\Mm+TWnL/oԋCpΊz:q߉2r}(ssщ)tovB>Ky4}[l&Sm8KnWCoZ:q}1r((hs,$suDny2]}[݉GQvSWUJ;XA~[8_9/bp%=ebg ކj /oyZWR`ZI@^A1`85c/ Nf$Gi%ۄk{jmhrzY^SQjaIc@xLe7/hZ.!j$0lԂlnQzq.u|2XpdPfH]i?k7m.1n$r|t6N|Wv-|w9$8|xV}ym}z~}Uyw(NlyxFz&x>qzy6zzg-x{${.$'{w{ {|>|~}U2wn}Mx}F0x~>y ~w5yu~-QyG$z9zlr{/}6xTuMTvTEwJ=w5x2-3x$y3yhQz̓e|/ T*tLuEhv&=vu5gw3-w $x.Dx}z+|q`^ASsLtdEu6=_u)5Fv=- v5$ wlRwy~{\QzJU"BX:[2_1)\b_eLg kdrpJzDQ4WIiZB]9`1*c)fYWhukH nRs{P]I`Afc+9fUe1#g(jjYm+l-:n 7qxkv}*O\cHPf<@ņvhx8܆ jy0lv(j]npK+pS>1r p1t\+yI~[NDŽiGk@:Bm8koP0ap(6|r?RtcNu w{~NoGqB?ǂ]r8&s0%u4(vxEwx A{ }MhuUFv?ew7ʀxz/sy_']zMK?{Hŀ$|T N~T#L'zF.{? (|7}/ }'~HT~~~  bPL_}ŀE}ɁA>}7L}/};'}ła} } ~!=~K|sEEJ|>g|7|v/|'|m|@| }^T~0bKr{:D{w>+{6{yJ/m{'{Ԋv{ኾ]{ɉN "|‡(}ƒ}HИQHAܖT:rX{3[+&^# bUe Hgkjr2{[H=/W)AVZh:0{]2Q`_*Hc3"eehRk"7o Pu|G]@_9b2De*gs"ōil1ntr!]w~Fbb@ \e^9fg1֌i*Ik"mpo։q‡)u.yFh?|j84l1nnb*p"~q%stu( xaB|E_n?o8dLq1Lr)t:"~auKw ]x n2{t~Dsu>=t8 v11w4)ۆdx@"~yZjHz{ ~ D:x>Zy7߆ z0i{)ń|h"w}<~,݃$U {2D0D3~&> 3 70ǃZ)"s-܂ NqTCÄ==7gH0)FE"΁l#WɅ 7 wCE5=m.7;;U0a)Ez"瀁d !>͡P8T1읐W*[*#4^`,ady ]gXls|Y>:?V8QY1\*И_#jbTeR1&h PkFov0\}=͚\]7f_1Ya*Qd#fciek (nrT$x~=8Fa7.d;0nf*Oh#gjTl}xo ΍qOuzY{Z1 [{"]|f|iDw~O>{CKpGd K WP KS>Ws0Z"\ievE"(WV\0XӃ"[tw?d!,uO:uz?LnDbHVM^JQK7>ST%1!Wψ/#DZsdGte8藞yw=͖n BubpGdVKJPIZ>YT1MVo#YXcot}b7"y< mA{bF^VlKYJOx4>^SS61qVSq#YtPc;^ tÉ]GL}W^Pp`TdubXWd\K f`L=hc/pjOf [k-i[pkX>|6pbWU`{oZXo[\N\c^_IVabnJcierNCugGԒ\LQUP+'FT: Wx-Z7Z T]nSgav|Q=DqB8AgF?\0J?QO3SES=x:"Vɐ-YH ]#tg/,v;耉bLtd9PiVeT]g6XQh\WEjr` 8l+c{+"mfzni? ztkG~_qY~]U(sY_Xnga[\dc^PeaDgoe8ifg*kj:l5l rna}td|Y ]^q[L_f]b[=_e ObYgCdj7rfl\*-hnujp4 qtq} w"{1TeVpXW{g\e^Zi\Z/\kTN_rm7C2bo 6dfp)fDrVh:s p.t|yyQ7m(oT.ndAW!p Y:Z qlM\rB_t6cbEu3)d3vLfw7 o x\{{xRN/tmQ|ucETvfXdWw:MMZxB]x6`|y)tbwz7eEz vn{z}w-K|+lO|lbjR|WU|LY}4A\+}v5^})e`~-d~Z m=pz0vDISlLFaPWTLEWqwAZZ;5])m_dc%"lyfuGJkjKaNω_VRsKUA,YZ05\S)^bUxkNy tEjI`MRVEQVKT'A X@5[W)].a\k^`_xt[D^'jZH;N`?LUOKS&@WY5Z2)\ &a&(j xDwiLljPak TVlKXwKrm\*@n_3p6c(&qof1xrh wkUrLucTkeX`(g-[BULh^oJCjYa?kd3mgm&9i*ia2kjk%lfmBnFo Gtq~wr[odKh]fS]`hYSbNj]H`dlN=fn31ho%j$q+lr vst~.yq!WkfZmI\]nR=_p7Gb q|5cRS[ UAXRXI Z֎?]6W`,Yb!d͋k;i[ jqm{灤eulMd\uQRxv_THvX~?wd\4x_)xbye{h(~"lud$qTZqWQ6rZGsq]=t]`4 uSc)IvRfwBi]ypk|owbl[Yhm^.P o`FpIc^=q}e3Wrhj(sjntlwn2{"ryaibyXcj{dO.kfEmbhWnggjNiilE4jnA;lfo2rmqf(@oarFpvtIRtCuxy |_eboVdqMfr8Dhsc;wjLt2.ku(*m}vfnwry .w{ ~W^`uvMUbrwM*dtwD5f{xf;hky1j>y(kzm {q|rv~k}-]^[|UB`h|Lb~}pmN6=qn-grp#tr?PtsMxoum{y}W j)n2O k~oFlp>nBr=5os-4pt#rvs+wTwx|z|.VSgtlNi4uQF{jv1>#l?w 5mw- o+x#phyqzu|8y~pUezMg.{ F h{=je{5il|o,m|#n}pL~p>t}xpUcۀMsefEf=h5Bjl/,lj#mo2Ys\x^:2"Tb2M c׆EReQ=^g65#i,j#lv$nL sLwgSETU`Lb EdF]=5f5 g8,iމ#kCm1rw{ bT AMjK͂QCT;S+X92[)Ԃ:_, bZ-Re( _hZQnxR~SJ~VB~Y:~]-2`B)RvcDf.h 6kqzpQ{Z3I{;\A{|_9{b51u|Gd(|gi}bi4~ l! +LoPt{Pw`zI!wbAcxce9MxgL1yi~(zOkhzm?{o ]}r7Jw]}MOtLfHhth@ujy8vclK0w2n(pxo_xqhys# |u}y~NqlGr_n"@Ws4o8}t!q 0turw(QusjvuOwv zx||iNEo2rG;ps?qt8-ru0>s*v(7t-wsuxvFz Vy|%S|~yMmxeFny?oy7p@z_0qi{(&r{s|t} x~#{_NM:kA~%FRlE~?0mX7nO/o( q(rLsʁ wzLiEj>kՄ*7m$/nZ:(oop|rڅ "v@zBTLh@Eijh>j7ikĈ/m1(n{or Rvh =yۃJkMdCQ<T4c9XE,U[$ _$ۇbKψLe0ijoyI8SlBV;`WY3˄]+߄`#cÅ,eihglZr{H}YA*\a:́_+3Fa+x d#}Cgilo|u|G_AC~b :?~dv2f+gh#Ik6mZ/ogrsW|8s}^1t}*ruZ~#-v:.>vހxy zځ|܁DqQ^>q8GrHT1}r*hs߂#8tڃfdu wx2 z!|WDao܆>bpe8p1dq*`r$#Bsgtv ye{키Aڒ.M;DP4zT-aX%*[&^b e܉j_qC{@ R:V<4-Y-x\% _be =h/mm,t |s@-wX:[3^,jaT%s'd fɈiB rl0xtp{`v}?C^u9R^a&3 c,Gf%.hU充jхl osƒx~>d8҃sfx2h,j%l'n$p 傠r&v{>30iu8xk2gmp+ڀo$prm7t%AvJtyv}=~n8)~p2.~r +~s^$~t!vl"wAy|Ȁ~=n|t7|u1|v+|w$|x}Zy}g{?}} !~TD=zy]7zz1z{+z|o${,}C?{~,{B;|zz}JW~m#o rs w{5/Tg0?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(؀+ˀ:JXkeVtA,|〟~׉~ˈҦ~ч~󆧨 [56j_M.Ub@p, w$}ߓ}LВ}=~e~#z~H}~tAi8~T~͆@'~2+|םB|"Υ|/}s}F2}||}h,~S~F?~p+~| |0|INK|gϣ||ݕ{m}+g=}S}Ҍ?!~+l~aW{{P{ӧl{|'w|k*zj|_fo}R}q>}Œ+{~{J޲{Y{j{he{n|y|ae|lR}>}r"+}D{ďa{ȯ{δN{0ˠK{lv{_x| e!|kHQ|ȕ>Y}%1+}mzhz8tz)!zU9{.ŋ{q6w{d|EQP|m>-|ڒ4+}3zB z[gzȉzNzv{;w[{d&{ɣQ |> |+}z*z|ōzNz\z{v{K,c{P{ݞ=|f+|܌(}͆3}a~~].8~GzI8]fERI]>T3*qRۦㆣ2ʴ5zCłЄ2xre"pQ^Ń=h*XUҐٶ"SfmՋ՞ۂlW ^w@d}&P9=&*i]/,̃d~<򰯂Eav"c OЀ<)B顃rƠˆρ!ғus:bBtO.Iv́p*6KOErz`D_M=};U*~щR ИxžB*җG\r',_ My~Z;j~̑<*"~6ҌϓTY@,ݽdu !&q~._H~¡'M1~ ;F~*-~[y4"7ocR6JfI~q~^~L~`o;*~Yp*5~1#v|8s|uӋ2||ۙ9}L}s~n`~M;(e܍ k{6HF. rz_)MRu:y#( !ͱ(B?$D;%'0(q][7^̈́LL^΅X:R(t'<%xuډڧ †ނ"pFӋz]KV'9j(YɄܒԠw7dJ݈9Tbd=oDW]$tK+9e0([^8UgĈue$$M^n\5\p9J9,Ȋ(t ٯF`B +~\Fmm{[ւޔJI*8n(KE-]ֳхͫ[ ֦q~wlփ4[FIד>8́t(5T4-ȸ9F }lNZ;I8Ґ?(< 1݈Ɩd2*^|ԃj5kZHIEBx8~(*l Ǎ>v2|78JkpYꁿJI 8a`?(j{'{{wK{ۡt|'!|~}Dlw}[-~hI~7&儖Guhr`O}WZ0kӉڂZFjH׆7|&ҬlQ߈ۍVH|)jщIBYtvH;z7# &ڃ֐8<o{ *iŠcXfGa6Ԅ&փENϚnW\ӭl݌k׋'yhHX^G4#6I&҅8!𢚫$Dljxz'ˣ#}v:hiVj wAhf/VHߖ{F6&'6~Kc 5JHnԩv\Lme)UE95ۏC'IBa85Y)6֖KMΉwuae\CUBZEf5Ȃ'Y]IQP&}2 td؆T) E&ǘ5k'eы)qzwpzۨ1{>){|0v|f7\}mUI~E59~4ÈBa%/1M sĶәV|sÒ.ue<ӁvTߋpDr4z%@ŕ_Չѥ/ȇte(dYMxT*>D%2%4:C%N/%ȕX!{*sҊcljrSĈC†4ׅ|%[Ą/³Q)|XhnrSbƌNwRQkCKRc3ӆdo%wHe[5M5@ґ20`q*bpR^莴B3W%Æ*P,f/B5ԟ{3pacKQቌBl3%Pg П A-`p)?S`:(Qb=BK53r2%ڂp疱Cn~/oI`Pو&A13MT%򂝉h♙{͖ٓT} UnԦ_`ĠP`)Ae3+&Y˘֖'侠E?|챉m⌭ ^݊}OAhV3s&#J(z[zp{2Ԛ{~b|)o|_B}nPG~A~1ˊr#݀+Pƛ#P}I>>n'p@^⑶GOU@an1䁗#GKd֪ЈӜuus|FNmF䅯^%1O@+1id#цÃwݟ-ӎHeԌ{TYlsX]vN ?Ћos1@T#N7բ((RWRkzbqk܎\ɐ9N?{1"z%$ ɅWŠzDחfQyx({j֒r\$ϐeM0?/V1$<=pcCm͖rKox͚pj'6[rMӐ>-0$fćiCo^ϫƕueQcwٔkipƛ[ L>׏09 $^D/meEǔ`I ~$+vJhZ]؛ML95>b 0І獀$+f Hғl6wv!gJ!G0$‰GWסtܒ(ƒޖ紁uyhgcOYYi)K{›=0m$ԃ%ƭz.=z{{uG|g|YA^}lK~#<~.",r߮_S &tfϙ0XʁJn;<l.Ռ"PςHY ,/8:^t f2XBJACaSUG:o.^X#׉ƴz(zLjN|{z{mb|`E|S}zFr~?9o,Q ݊#&jlk̀z[lŢ)_REՁ/8ҁu,F! 5HƳex2xyTl)=_:lR:WcETG 8E,<{!0U=D ߩv6xk^QȘևEɆ8Dž,4!RJ$ewפj٠tJ^dQTY$DN8ZI,6x!}? 8ow&j.]PdDb،>82Ί",A!·,7yUˬˠ4vmʙi]?P~Dr8d,Jxz" ^YO%çguzhMO\,PCԓ@7,N":t2iN맸t5hG[ћOC7,L"dLDZI+t9g[hO7pC6h{~l{qì|1eY)|Y2_}WM ~A~5MC)ǀg:f\Êwm}G+q1>dާoXʢLH@ǙC5))ƐދwIaҵ͇x}/pdgȅLXd LbX|@05 )ˏy ܃pں܉(,`|p%c3W{L·@S!4u)ώ 4LS;48{[GodlcmWJKD@T4֒)Z r5^Դ'{Dtnb%W!hKh?4Ò_)ć E:˞z}nj}boVAKH?4狈*D!˓M "z&m٩aOVZJҚۓ~?1X4z<*&ҊF*M;Ec1߉'ъ~ ؝,r7MfGx[הPf]E;w1X( }vWqĴufKқ[0\{PptE͞w;sD1݌(,x Y53Yh}qFeӮbZ̨P$nE ;`Α1l(I |άpس.ejZsOEss;Pjh1 m(b U>|+^p~neqZ,1O(EQa;C1(ui9 ڈsZ~v0}jr}` }U~BKg~ATdi76.%Bdfu jl_޹&U`K5A0.7ueg.&*%;׍ɂ΁9˂u;jx#_TQU:&K=Aτ7i.,q_%[7)̏#uEmjg؋_U-t|K BA%7d.1͆ %w*Ere u`È|j1{_r厱U"J@pO7bS.C%VŅ$Wu ܗQiݼs_%2TǰJéЎ@飹7c._m6%4pڀ2͟ tN i^ⵗ^TgJ/w@֣$7d.xՊ&iAwPGtsˠiMVD^T]җJ}9@Ȣk7kv.J&GN֩Mt2MSiѡq^YuT&?MJ]@7zp.ˍ>&t#qok)shź_i^2SKJA@~7{ .Օ_c&A@sh ]곗USѭ\J+#@7f. Y&o |zo|z̑}3{i\}| )}|~ }/{~K}gn~~*S,~~>~*(~{,x{o{ta|k`|ǂg}zX}lJfB}ł R:~>L~dp*~5yOAzrYzC{b{͈ڌ|4y|e/}Qa}x=}܃*\~;;yTyg}z zsz{f=w{xd4|gP|=4}a*&}׃lxE؋xΞAyJ"y!z5j>zv{M*cQ{܍O|i<|\*}rhwTx(3xy(NRyƉz@HuzՔb{nyOl|<|*(}VwՅwx'ex|,y<yНtzm}a{ +_yȤ!Mz_;{'*`{ދ眃tx؂yvz+9zқ{ˁ|?ur|bAI}O~?;ހ~)lẃ< D#;큊ZtLsa1dN/xN;SY (5eڋȀ!Fvh$l醹s!`8"MnN:փh(Ăk t{S'6?2r9Y_SILW::g`(`EmVw~ј=~~z~/p~^~ŌL,~݊2:~(~)6~˹~y@~HA~"ޔ~Y~zp~5`]~XGK~u!9~(~ܮ~FF~K}Ч奎}f}_}o>}ϗ]%}K=~9~1(~/F}}}pa}MW}JՀq}Qn{}rB\}J}9m}ߍ(}}%ǯ}pHj})v:}L| }}m}\ }E9J}i9C}(}}cƝ}=ڴ_|Q=|̸ϐf|²d~|m|֥b[|J?}9 }P(}h }xղž}i|q|Ǐ|~~|l|[9|J|ݚu9}(}'*zє+TٯGpo痄{_Rj!ޑXx Gہ 17T'E;$᭼ۤp[{Fzo虡i[zXL|Gw6:D']h̅ij~;NWyhPWGW6'qMt͊>yb-D81sUZѩ x:gʞW:juFĀ%6'_^GAD44=7wgSVǀ!Fz6vVx'~ʊ&VOhXwЁ^wYfրGVkF>6Z!'~͍vwlA#x=^yIyyzh{Wj|F6}b5 ~:%B˶`)],YNjSuwxy$gVƀEE5]}t%Id}ȇHRUȉwXtfM U1Em5%҂QRȧC;ɆvP҉ZeΆ-UFD񄘅4Ӄ%icƸöoeBlquIG8d5WT-tD~"4%Ɓ8u+i-LFtIӓ d!ŐtSD>4r%uՍ `w"KŞGslnclcuSv`"CT4NE& ˆ汯eR\Iѩ 6pĂO=rb }R fChJ4(E&Oº.'.-TWqɡbRiC4&.`/bܠZB+zpYalyQvB‚j3ށ^m&> 5pЯ5ĖD/Af̷ɆjpcU`BfQ?B2%3)&KSyJuv̡\gwPxʐPysr!Vzgb6y{LR>|0Bm}2.~#fO8~@B~TÓ~i~~~q aFQQAK2zB$׀:Uʔ慫_ ΐsU߄o`o>PP݉A}Â2IP$,X^^r!񋳍f~O2QogO_HPI>AI92B$FH@`y^ԑ]^|nd}Bn0ތ^,CO@҇114$gjC8OO|70mIm^4+O*@baf1؄$䅸wcsJ.{Q͙l ]\N@1P$q˶KĭI~HQGLzizOk\N5[?Dž*1}$̂5ߦ*MS+9#yv7jk,\AM?qY1| $䁽-ȥ)"3rMܮ$xj/-[yeM@͙?&1]cn$yG@aŲQkwԮi[/EL㆙>ᕏ1C.%Cڴuvwxy^Hykjzb[O{PM |A>_}A/ԉ[~R"l}$}ԕ~ ~/xF~xiϒ~[ 'LrM=/€["v8ۅ6؛͔b݄ZƖPwH߃hr7//#{tt'HQ퓯r>Qd{؝#VʌI9?;c/C#$5R  y qVAcՎ^VCEeHՉ_;b/Z#݈רI+H󻰌Q7~fNpԪcO`XU֌ H™;m!.!#ς\㨟u?vw~xjpyYcrpzUUX{OGL|P:qN}b-~!覱}-}dt=}}}p~*b~U~Gi:+-߀v!7,kpu|ΜB6oO-bTGp9S,MH!dgV>ꋁCtɉ{naUS+Fb9,̃!eaΡv?{ m` SsFS O9,F!Qu)󙭔ҡR~֕kz'/l&_-R둎+E򎗋'9J-,Q!{{6yb5WlK%_m Rv(yE195A,M",@|3 ~(+pu1}1$;}cx.q}l<}`~3U ~Iy%> c2C((ڊUKha[wk(` ȂTgiI,^=ٖ]2fd(;8r-v߫Sk(r}_TB*Ho= 2ёЄh(KJhb v8NjԌ=_|Sٞ$H׈=y2‘@'}4J~,d#ˀzq~p ~ey~[0~QCGl>1G4i~,-#Ȓuzooe3Z[ނQ.GB>)s4,?#-1z7yGoo#dZFQ";Gi>&|4ޅ,P$3myıo(ǎ9d쌼Z0iPpAG}->%5"&,iP+$R8ׄcy n" dsAZp|EPGP!>+5n+,$ˆW$ymÃ=nd8AZ-P}G*E=򠍌5 ҋ,"$ď1UfyAndEc"_YLPGG=65C,”vy$󎪈= Kxˆ nc}YBPDF$]=ٟpu5,%2ވx|mռ*cr#dYl>Ow=Fɤ=ў5)I),%Bω F$x2mJc?ĤY<٠OFJ=ʞH52쑂-1%_c.syzuyv òz|wkzwٝ#{bx؉{yvx|[zc|{O}i|nz}u6{ja| N|;}<) }v(ҿw w͇xw8y'yڄt zY`{GM{;4|S(}Qt咈uؐvӫ"wp(hx8yNryЈ` zMM{]:|(|t tSBuؖv9wvxTqy-_6zaLz։':i{(|rtsdydtTu6vFv8awƕ4px7^wy7L-zg-:'{?2(| ޝrήsctnuyQv^pfwIpx6]y Kz9zM({)4rdtʝsU\t:Su gwu򤴁pvoRwϛY]=d(~TOD 4~&+~ ܤoBSt_~כd7~ŗT~D3~4~&A~VʀGóӣL[~(Z~ps~zc~gS~b$C~UG4~Ay&S~ µ(ˢ Un~~bCr~+b~ S~mC~4_} &a}щIıUó~Խ~i-~$r8}ꪄbv}դR}ѝkCZ}ɖ4E}Őb&m}vq=sOЊtuvtx,d7y[SʅzC{3m|$6~9zTzۋ {{{,|msZ}c7}S~B~3.L$Tm/ʡÂuρrFbRRPQBn2āG$o(td'UvJՆ oqR3asQB*2ÂJT$vNͮ)7.<-:~fpUx`Q7oA2х`$ż Pⅷ~coW5_mPy‹AN2q[\$ŀJ&^A=ЌÅD}un|_5O]@2P2$3XN"zݤ|/mP^Ot8@P2-$8'w̅{lڂe]߂JN񁦕z@Q2H%qbԅKE[zۃpDl'#]KNZ@>1 % 1ܵEĞ* N jz33ki\ԁN%`?ʀt>1̏N%.~{ɕqb(rĚXt=1uD|2vmDw^by Nz??i{0|"~Myz*ΐzӎF{)z{l/|n]} N4}?~L0lh~"ۃŴOȁrZDcyҋ߁k8b \UMj>10J݁ #v!ڑ*هuxڋIj`[XLM>h0,b#-`mq.+ӍmLwӊi}EZ̈L[~>-;0#UV;ӎ ovNJhZ2UKӆ =/h#}ٮ񠔎GbKuu߉gш;)YK^=wO#/݂#פּl8KECt6gڗX􆎔;JE=,t/‚1#$欃oiYd6SO1t.fM)XR6Jk<ك/K#Ԁчr;XuGׁ< sW[e6Wƅ뛽I~>:yyzU铹zr{e=w|{ݐn/aqT&QF̌: f-z"[OoqˢlJdQz*mɎ)`Ȍ6SQFm9͆-i"~p(N~z١lԝ`ݚ3S bF9(-R@"4f񓍔PچsܫyK$lJ_YREɕ29Gސ-]Ő߄wjM]P3Pѐ]C7sy+1 Wr/ԏ͆_Ņv@;iE] _PR Czz7J+4{ Jꎇ%݂!u_Mhʔ\cOϏ}tCLc7b`+5z ąe”ʍ, |t}͏h([OLBq56+6c ̈́T:o58%s]gZ[/]Nێ B6p+7쇘!/K㟴\ݜrfVZ>Ng.bBL6 +1!Y݆cȩQ›~zr'eZ_:MҔAE&6W+$&H!|4iH}VQqrf/eY"Y|M{A6#aq+ًm!4\ۉH7b}$p/dْy\YӟM!CAW5"+ c!%}qS|r|ksp=yud2vdXXwL4"y"@z4Cw{(_}E;}xGx{youz3czW˜{KÕW|?͒}x4*~^(ыY鈅wv*7z8DnRbڛLW6KZ?SW4(-ہyم _yӡlmgb<V@Jq?P4y(fhGs]xŠwm@?la숆V(Jb?#3)τG}בvx0ɏ}3nj_)< çubMw~Ǖ$k@`nU1IВf>)3)") "m妫ՂR%vƟfqk?ڗ_ݘ)T9Iq >Kh3})'No R )p9vj_@(sT5ٖWI=_3^)#쉠 žV4ʢuQإ&i:U^۝SHI= "35ʎQ) [Sŀ*NtĞ2il^E|SbF&H]=ʔ%3)X ‰Iiq~s.rתetmg8u\d)vQ}x@Fb y;['z04|n&Zc}}Dx}xy-rCoyfNzt[J{8QI|FP|;1X}0e~&҉΀H|#q>forN[swPEϘ#; w0&>eO|pe裟#[PTEԃR:0 &A^{Q{KBpNeTZO AEB-n:N0k&ދ3ԃ zOoldV]YfOyDe: 0Ն&,y1od5ՑYO+D2:k: _0ku'5 Nx.mMآubX.dN —Cݔ`90WM'=AjMPwlۤb5cW֜iMŘzC90Gӎ'CЅ'g~sZrssiwu_>v+TƧwmJТx@;z%6֙{-R|$'N~Q{~*-xs yi+z4^RzT{J|^@`}<6ɘ~!-a $\q؊}s- 3hN^el]TBJd.@xD6急-o= $m*8},rh]/c^S냰J1Ny@WC6'-{$q|Xr7L,gfP]fS&I@,(6tm-߄$S%⃠|*qQg^Í]0SBNI?]6҇-:}%h2q{)q4Xf6{\ƧRI_Y(?љЋq6}E-%7T'{pRfv\^RrVIؐ+?P6kŋ-,%WzKp::GfI[򦏘R9Hםb5?wڐw6UN- %q'Kz Moïߣ"e['|Qꡐ?H?Nv6Bꏄ-SZ%ɉX]y|oXeF[IӠ QKiF_b0V L֪CH];62}*`"sHiމ_DzUѯ'Lχ5C٤i;2?*_"߃rh&}^ UzlLfCw:_\2 D*7#6J<>(ar<ەhH| ^&U0ˏZL+uC8:2n*Ɠ #k>qq茥r䠾{t'j_ukpY8vEHBw7y/'zbr m1=npq7鋗rxzsiuXvFGw7Wxݍ'z!vlfpnVopܲۊrysaUhtzXۅL0## P8̕ۂއK*xjQJY[M>b0 #8V':ẃ3biϑ[nLC>Ri0j#2a Ђ1q.4*vh`Z]NL ݐ>0KC#~Նhׂ`۪ʒqS0ʢu_g7YDK|C=9=0'~H$~N!l|Ozu7 qgIY,cK)F=f~v0~$~FDYEȴ&9tʩfd!XJ~=+~k/~k$"~lΡ:n,pX׌qvshRsu/Yƈ:vK'xQ{ͧRG|s8nƅoavTjtG7:\׎-܀|"'z5]W${0(n "a&iSDF΂j:%-"~N?z_mur`rS{PFz(9܁H-k"pDclnpbp^| lqnsazuxo8z+{ n}ۖ~tc$Ju68vzYwmx`yS@ zEډy{8|+P} W X>{ϓ%|e+|y܏^}%lȍ}_؋~RZ~pEm~83[+ ,p75u+-ʐ=xՎ{kт_-[R -E 8S+) ԃ`1`{-wЍ=ko^VQuD8F+ۄ! Ҝmɐ/vҍ-j"?]P߈wD4 7ޅ+фJ!;K6Beuib\P] C؆7 +Ƀ!d 8Ӡ!ٝu=Rh\VOۇYCw47n+;c!ߙ7=;t?gI}[4ORFC ֐o7(\+!J97F =ύXs|g7/[!j=Nۆ,B 6 +!MO4A rߋT.fZ(N{6BdCc6ː+~U!рLJ֗ޟRlݜrnpNsG!qfꔨsZ6ufxOZLynMzAA{51|)lg~JaN{{}|-qp|eP} Y[r}M"5~@~5>)~Zł h$|p9d큷XLy@X48)+QYr{ۇo~cȑ9aXL*ׅ#@T|4҈)U؄ؑ<цQzExnҒ"c WtpKP?9I4) f9y͔“ ne#bi+VVKBۋ?ĉ4%)t BaՏ_F}КxSmY&aďV`bJӋp?cZ4R< ) k񅦏 z*xIlAaXGU΍'KJ[ :?4ی) ["->wRkߑB<`}UNҙ I񊺕Q>3ㆉ)~pA EOh !vokP`T挍Iu>qc3GW)s/5 oŦlがnv<5p@jÜq__sT)uBHv=x1zo&,|Lw~Vťs€Atup ujv^xSyBH;zl<ߏ{1ۍ|'&b~,臮az1{ t {iJ{^|S}3Gܒ}<6~y1Ԍa+'I:ȉi~= sh]uR'G|O'1!'r(Dž‚݇Ҏ|njr g\9ˉQ䈫F;U1'لׇ L`|1@q[5f-a[GQe>Fd;njډ1'V>)暠{fјxpJeޗ[)ёPF -;kz1jY'TlsVzx9oܚ_e-NZh&P-vEƐ;:1%ч0wMn'mocqPY訉rPJ=tmFv%=vw4 ~y+0B{d" }|~wtAm.OuWcavcYw_P@xFy=Zz4|=+OM}"ߎ"~ v~zRl1zb{oYA{O¢K|F}>=<}4~+kt#RMIWu벼;l.-\bqX᥋uOuWFQ=4؁2+q#QubІ kKbQXwO~FL/<04+J#tk(a4XNŸ׈'E˛_<̗4s+T #7Xk2m񆝬wr`ysɄ+hu7WvFx~6y&z>jflnio(qpxrgtr8VuFPwy5x.&&zrʌjƹkߗ]m ro-݇pwwrKfsڌVHukEv5xk&CziIոLklݜ8npvqfsUUt@Exv^5ex&[yeǁhضjy|l<mZouq3earؕ{U't|Ev&5=w{&pyWGh-i-Tkm_+o tp_dr`Tt yDu5wj`&yvsuokcqISsZDTu4v菊&x0$xcixkרy=myo݇zIqw zsf^{quSU|wE|x4g}zh$~L|2v3s0vtVwuvjx2vxwuyxeTzWyT{&zDk{{4||$}}tU|du(| u|v}6w}txu}dbyZ~QTzH~C{63|?$}rۅC/s˄^t9nu҃{vuswcx|SaygCkz3{$|q!pr͡stoBuXrvBbw/Rx؆By3fz$|qopدq̔KrstqvHaw&}RxLByo3:z%{ٽosvq r'珊s;QtUpuq6avQwэB3x3z%{8oO+plqqrsÚ|ot+`mv Qw^Ax)2y‰%7z;Qnװooq\^rT~!sANotj<_u&PvAx02yl%Jz89nh oyMprq}MrҦnNs._.u@GPvLAKwؒ@2y#2%[zaFn o p1qN|rxms^tOv>IAwj2x莔%gz2l~i.b~k^'~mt~o`~qCp~s(`~tPvAI?x1zT#|;~|r |sTw|t }u~}Avoi}px_}yHP:~z|@~t{1~|#?5}v{ z{A{!{{{|}i||~nV|d}^|}O}E~@Z}~1T~.~#d~kyMy6zY?zh|B{2m\{^.{N|?}}1+},#~'׵xΧex˘y[ȉy͈{zAlcz]c{H N]{>?|Q1}P#}?_wx S^xyzyZksz \z=M{[?5| 0|^#}.v̜BwNؖ*wҗpxY yxjyw|[z&9MIz>{0|2E#|ńұv9qYv\w6Gw›3x'xW4ix5[Ry8Lzn3>{*"0{҉$|kduĬ(v7v4wCww:wڝixu Zy3MLSz>DzŎ0{z$| ٯGu]uΰ_vJvاvmwpzm0d{0K$*{⇧Qu".-"z1|~s~U~s~_(r~Te=~MoW[~dI~~;~D.~"~_}M}՗93}Ǖ }q}dz}V}I ~;~0.~A"~A}[y}G`}8~}2q"}: c}EhV%}mH};W}Nj.e}߈Z"}ㅕ|񨺘X|٥ |Ȣ5}|ÞpG|˛hc|ؗU}H}6; }cw.F}"}~|]U||m||go|obd|{pU|:G|ۓ:} .*}:h#}SC|Nz|5[|#|%|Bn|$xa|/T|ZGf|:|Ƒ.|#};th=+$jul~[npȇpcPrUztvG.va9_xT,|zD E|ipiqيs5}*troubgw TxvGYy9{),y|| E}(x2--x4By{nzBnza{T=|lF}(9h},vT~ ځ^p݆(zЅfm#`BSnfZF+݀o91S,tȀ!7܆ՇF>zylޅJ_݃7RƂ!Ke?܅\xًtkƃ:J_&R $E=8=,Wc!v(52Lq˄Ow>j0^^fQDՁ>8jʇ,GH!R܏|L] vƂj,/]Q7*Dlь8(`$,3⇵!PNJ8IEu߂V-idə] @PzђCk7],9!~+LLi`uht\x,PzICV7g+9!~ރ ob?tth).\O3vCN̔7ea/+~!~~h6ۑ~jluniBp\rO݉tBVv6Qx)z넛|ƙ|oڍqucFrt݌t;hYru[wOCxeB|y6$<{8*|D~<Zw51x0*y sԋygugz[8{XN|'B.|5}*i~I)~㍃~~ rȊ:fokZz-N$ Aօ5؄J*ԀՂ͕M"ĉ}ы1qƉۄeLYjMXAvV5O*!BY .WrЋ|hpԉ-dއ Y ӈMɇAˆ5sŅ* C*댨ˇl*m{ЉʐpDd(pXrOLLy@R5DM?*= n2݌ ̆nzFo5cuLW܅ِLڍ@b㋖5 Y* ҇0 Ջo>=yۜnabWCp-KsE?|S4̂|h)s [֋`䥉y']mMb 0VK'?%4&H)$ ʀLÉx~=maVTϛJ΃ӗw?aݓ'4b)؀ ևݚhR6jy)lmxnaʑpV@}rJXt>lv2Ӊx'z2}oqx4urlosaqu^UtvIߌxJ>%y2{E'$| o~^vVvww&NxekUy-`Fgz T{zIk{=|2!}'̆p~`nj'}Y0X}v=~j̐T~T_~p~TZHY=$2x'Ҁv.8huYi{}^@SɃ H=X|2قZ'7-탓NJ.t,kï^ S$/H )= Y2`H(&!!z~/=s`hl3z]rmRG[<Ňm2@ˆ(!NWr}JBrdgh\׋tR!1G?[&Q$fFn͒;Ն:p11'S<=dDzҐ^pYhdeƌ[/Ν Pʼn`Fz;1W'䂹ׁ$'hxzjp.leEbnZpOrE Zt:v/Px%O{}s2oKyɝpoFr5d(sYu%OyvD[x59y/n{Z%}~ă*=uxќjvnfwcٗxYRzyNzD[n{9ʍ|/}%Z~O|]w՛M|m}c }xX}Ns~jD~9AZ/%܇mz v]lbW0WX CM*9CԂ%9n/K% Ղ@A)v{ka|WyMxCI:N95/~&m(0\^uL,k9[aދVoMvBM9t$/m-&!^~}xtkjВ`RaVx鎮LBlUiKǍAn8=7.,& kӂt| ħorF0M~5\R,h#׉|)wm!dTсZQ@H}>5e,$˂%vףmAXWcZ4;P͖텺GօB>b5FJ,$&#j@Ovlc/oY^PkSGWE>+W5*r,$D{uU|8kbېYYDʎPōEG=֊?5,ICC_PROFILE @$X=tkSbSX>O?FA =^4Ռ~,o$b؃ԅ.tuYjauߙXDǗ6O.̔FY֒&=j4,X4D$iK}sTj(aWfNݔoF=74ʎ,Fz$n8p)igCk]mT֤okK٠qnCs:;u1zWw)"y!"{*~ pof˫nq][rTsKuzBw:%x1Kz^)N| !t}>;oIufM(v]-,wT%hxuKLy{Bz: {1V|)v~!0wpMnԭ%{de {\|{S\|J}|B~~9~1sU)!*҇Dn<,2e-D\4&NSQsKJ\B@y9ΕB1) "3n&/mLdCL[^RퟰfJRB59H1)̍["eJqP m d5([]IRWJ TxAЗ91c)ą3"#pl2cZR>e=IšA 9koG1wه)<"}2nl"P`cDOZpQܝő*Iq#[AX~9@ꋾ1`W)닿&"Lj'sĄk{bΤÙ^Z-Q:I*A Y9x1K鋭)Ul"هŇG;jrk1pbbKYȠyQ?ɘIH6@󕦒81:0)"uX"fj]=l1TmLYLoDOq<|}4'~-W&9 2Ѐ^dϴ \4SΫ3K̀CܢHL-Ӂ&h w`9d})[鮾PSVKr|C{5Bku/3w$x :cɮfd2hhj9lpn`p%QfrBt^2v$x`c,DeBgTj ~lon'`Gp1nPr:IAtB2vG%xHbBeMgV[Nior~knm_oPyq’As؎2u%2xaګd}8fӭoh}>kXn:m _!onu{_;w{OxX|@uy}41Uz}#E|~gnopr<|s mtƀ^lv%O w|-@ xڀ*1$z0 #\{l"n9\o4zq{r{lsۅ-]uINv?x30yH#{f=ke/m*nˎ<7p8zqqzks\tMv#X?Jw0yl#zճjwDlEhm;omy{pjrs\3tMuu>w,0xf#z-nikm7>nhxpIj.qړ[sxMu>v+0xME#yׅC3i%[jԔ|lMn%woAinqNZrLtu>pvP0w$ yD(hjltl@:m vo;hp֝wZwrL3t>>8u&0~w$!ySPh2С ikm> vRn֧ hCpsZ r(Ksꗉ> u@0mwm$2y$ҳzdKn{g{Ti@{ky~{n'j|Bpe[|rL}>t=}v/?~]x!{x^m!xnXykpyr&x'zpsizuGZ{vL|;xd=}|y/}{L!~O|ͯv[uwvwwLx{xhvyyGhyz-Zz{K{{Q{=||.|}"}~]t~7%u~h,vy~w;~uw~gxY[yUJz<{h.|F"*}'άCsXt]uPv(tvzfwׄXxʃJfyʃ uEsv.ewWxIy/h<z93.{3"|&Fq3rjȎHs怓t{ruu%e3vrPWNw{Ilx;y.z…"{ܨpq2rЙsϖqtӔud{uۑVvcHx*;yN5.~z^"{apq%y#r;N~s>q"tGcuSV'v}]Hw ;Sx䌪.gzL"{orp:q}rƣ pisџ%c(tߛ2Uv+H7wO;x.Ty#zֆop=~q[P}$rcosp%bttUDuGv:x?.Dyz#ziPcBf€i.kr1qmd{LpVjArQHJDt:hMv,€bx N{2lUn5Go~qps*cwtU.voGOx :ty,{- |ҥ}t}\u}v}Z}wo}xb}yT~.zG7~n{9~|,~}` 9~Sd{|p{|d|;}P|,|r}n|}a|~CT;}>~F}~9~:,~Zu!~z=yz={{{hm{;`|S|sFH|E9L}`,}ȁ!<~*?y yDz8XyzSlz_`{SoR{φxE|U|9|ӄz,}Cu!l}kx=̒RxEymxy׏l zEi_NzRS{>0Eb{Ј8|Y,t|υB!}8wk/x5Axėwy7kAyw^z*3QzD{V8{=,c|i!|ڄw"w8x>owxj{y1]yQBzFDz厠8D{~,N| !|vV3w@wϣvVxG.ixǜ]pyHPyED=z}8 {#,;{!|H`v?hv‚wuuw陋iHxpP\xPryCz57zُ,,{0"|T"c MfbhwkAjm^$soQr-Cփ^tk6v*Twx{bkÏlm9omvTqiփr]@PtsPSv#Capw6 y*^{+Z_|4st߃quugvh܂w\n8xOzB{&6G|=*g}F~b{'s{$|"tR|gv|[&}|O }B~e6b~*njA8sSFeos>ǂ6gZFN&B16-e*mց3 "W֊P9~75r5fʆZ"8MqA|5j*eK U"Jq#}1tqOIeT%Yy_Mg~Af~5~!*_~Ԅ ~lK~ژ]~ߖ|;~Ԕpv~d~X~~L~|{A ~h5~|Y*S~j] ~ImE~Jc~Z{M~Vo~5c~iXI~ Lp~ @~I5F~*B~ }MA}a}z}n}ϝ^cL} W}L}n@W}5}*1}3 } N}X$}y}3n`}{mb}jWd}\K}^@}f_4}mI*$}|T }xcŇ7f{{i ok^cmW刌pK|rV?t{t3v'yD˃{ȑ(kHꋭmRzso6nvpbшmrW#ht`Ksv?w3my({a'}DLr1sy?%uAm,vXa=w{VlRxJxy>Ʉ{3R|4(+}`xX~TyكOzx{Cl{a |UUE|J}>~~3:&~(?u>ߍ*wс;k'`M2$Ug)I#>*"3(Kف.Ѐˇzujȅ6`_wTi9I=т2e(OG7I̎u>j}^كҊPS؃"%H=2Ál(RɄkhV u~\t8di@쐚^5CSPH7A=7l2(OZC%~ؚ7s]hj]ƓoR̂&Gˁ<2c(EKX*}/kPrg݂]^RZÔGn;<240(:˩F|v1rYgX\ Qr_G#씡<_k2(2c~ԆM c}ifrigPkc\mQp#Fw:rs;/t0G$w%%yW|+k|OGmqnfĎp[܍LrjQt?F(v :w0@:y%{ }oq{ sUp7te捧u[!wPxOE)y:z09h|(&}xa~܄K0xz yozLe}zZb{O鉍|YE/8} :}03~z&/n:4xnnd1Y*OVWDÇlz:D90!&Gɀ񂕁.wmˌlcmYXNˇ1DZŃ:X0h&W//I'swmXbĊXvNTaD39ƅ/&edsB~v:lE%bcWM؋C9q/̓j&j7u2uc`k~.asړ}WZlMm]UCH;(9? /&gІ~UxOtjщ`߈g1V߇+M Bؐ8E/z&bzրUy}msjF``g V{ҙgL)B8̃oO/ZR&^5},dsߚfiHi _͕kbUmKđ0p6Apr7t-4wb#y||mjr li+n_{p[U=r7KItAu6w-Cy#{ }{qYrrhKlt^f;uDTvJΎw@ΌyU6݊z-P|#$}g'zwqXxgj/yZ]zSߏzJL{@z|6}t-\~S$IE;.yd~.p"=~pf!~\~SH:Iӌ@&6<&-[hy$mׁBxXVoLMeߒE\Q@RŽ>fIf<5?׊a6c-PƂ$cD2Iwŕene=[Ǐ*ROkI?ʅ6;*-F:p$j}0vݐ[mҒ܏-dލ[<䌰QڌkH &?KB6 -2?$/v>N1mMcMZQCQ_kzHH>ȋ5ч -J$<ց˄ulg˚cLԗZ$ՕPZG>`5,鉏$+Dy:tɓ,kБX bϏqsYpPGŔ> 5qV,ڄ$ 7sidjk@g a+0iyWכCkN\n'Exp<7r2uh* Cw!zW|rǢjil`nWSpN'r_E5FtN<v;2x0*@;z,!|#$)~!q-qh?r_esVĘu,MvDݓ(w;ѐyf2z*\P|Y"4}_Hq/wh5x_7.xV*yM6zD|{;|2Ӎ}q*u~e"jZׅRpN}.gt}^"~U~ZL“~D#0);`27*f"O&To~fĚ]EU!L[CԐr;,w2`*P"GmRInÜ߈f)*"]TLa]Cͅ:Y32*"n$)ev?\Ռ@TFG&KCI7:Όʇ2}d*"ރBmdגV\l5Sϓ_KG'B;:E2Y*~P#  لzl dkIG[iSgfJ񐥑YB4G:cԍ27v*y#-lG]Scϛ[?SJזs{m64|o/}v'~} {sgG-|T^|V\}eNw }Ff~I>~6ȒNL/''ތY cef1^zɁVNvNCF >o6/#k 'J!!1/RIfH^ U󝮆GMњELV>D6焂/&Ʉ(!N[ey']/hUM̉E>m6N/!3(%:!r l&7e/ő?]){U)?M+E_*=ӊ6`n/(,!gTʄPd!=\ݔT̛Lޘ}.E"fb=O6A>/.(/$!-?yqd' \UXT&LDF= 6)ٍ.̋L(2ȉ !܆*/_jeWigOj!Gѧdlb@Z"n93qK2s+wva$fKx{;R}z_EkW@m#OanGp@Fr91t2fv+*>x$zt |W~^yqVrAO s~Gt@,v[9(^w2=y+M"{5$|ƌ~G|^} vVFwRNۧix)GMoy@Vz%9/{62$ |T+i}y%$~ AW^ {VB"|7NI|GY}/?I}9+~]2*)+3%HHMStu]ԬV!N`QFl?h8VF21Y|+g%{BI]UϨ:FN.zF|?88ꘝ27+%׃^̉)A]NUaMFՇ?O8ח27+Ґ]%Ɍ;~!{\;.U@MٌF`?^)k8AY2.Z<+܏w%䋨 !)\TݒM#`F4S?n }^pI~8Nrr~{?t~0v~#x~`Յ]cטf$Yhy{jălFm ]:oSN/q9?\sށ0v)#Ax[+_Y-JbBӗzdghfyi͉FkUl0$\znMp?sC0uc#xw ^.Ťa&ra0u#r#we-];L`:c䆟eAx"h2ij[=mAeLo>rA0te#w7\vƢ_|hbW dwLgcij ZlL\oA6>Lqӌ0tte@#v򅫰[ɰ^۬;ad`vfhxiZ9l6L nԓy> qu20ht$ v)[2A^TaC̄6cvfCgi,]YkћkKn{h=q*[0_sߌQ$"vQpm_qbere㈉shytkIjum[w2pULx|r=yu=/={&w!|yﲑmyi3nk3p[mBqovL:;{Jx/,|Ry ~}f{æ$qxp֘rr,ss|~ttpuvc vwPUBxxGry9y9zj{,{|3 |}Ymoy,Wpyˊ*r'zg|sYzovt{b.u|1Tv|FxN}b9y},z~] |%~Тm[o`Opʁ={r#nrsbaTtSvF{w9\x퀵,zD!{ElzB]n"ozqmyrtY`sمSCuSFvׄ(9xS_,}y!J{kQ#mnnTyp)lq_s%RtEv@R8wͅ,tyDl!zzjnl3hmޔxodkp쐶_)rwR0tE>ut8wTP,jxۆ1!zVi̠kpm3hwnkpP^q@QsuDu;8rv劻,_x!z i9Ejlw n:yjvoΛ^qcQIs'DtА8Fv,Ux1\!y˅ޛhNj{قl2vqmˣioc]pPrDZty68"v;,Mw!ym|_\}bm}5e\y}Vhk}j_ }mdQ~oDY~ar7E~u*2wz,zOg1zi愉{7l w{n j{p ^|]rP|t C}Pv7}w*~\yP~{қxoxq8 ytrvnysizuY].{vPK{xCf|Tyv6|z*}| ~D}YJv?wwx{wy>uWxyhy5z\ky{iOz|!C{m|6|6}*|~}~touvt>wVgx[x߀OyBz$6g{,*|W) }"&0s\Et~Hus*v`wfw:ZxnN~yB)yN6+z삷*|{ʂ C|rFgs{V~7t7r;uf&vtZ/wcMxcAyiO5zf*x{Q u|/qk׈r(}>s˒jq`tːejuɎYvƍM{wҋ)AqxI5yj*qz慗 {Ѓ̓pŝ)r|Us*pt2@du8Yv=aM wQAxjH5y~*gz/ {p8e'qz{rosd(tXu˕Lv\@x5dy *]z9 {>omqzr9oYsKct\9X+unpL[v@w5Axԍ*Uy { ._@zf)g"ih{ހkomcoX!qKys?lu3ހew(Rmy.z{Rn҆5p`zFqnCsNcHtWZQv;K]`w?cuy&3z(f{}}r}Vv\}wHyh}x)m}xb4}yV~zJ~P{?~|_3~}1(w}8~Ȏ{}s|*~x?|t~Zl|~aX|~U}JU}lS>}3y~(~d~-z{΂/{w{rPk{`{| U@|VLI|>Z} 3H}&(}Ӂ@~jyv z vz0jz:_{MKT{\IJ|a>|b3|h(}Vxs}xyCu0y͐j.z=_zT{nH{=| 32|(|}BwxtYy2ity^tzSzHu{S=h{2|(|||zwp~IxAsxhy+]yVS,z&Hz=%{.2{(u|5|:wW}wTsxI7hYxƝ]yJRyΗ,GzTQ*z;F{-;5|0T}&p~~ڂ|5z|pA }@e}Z}}Po.~gE~:0w&h.=ybo@!dƀジZ9OӀfdE0A/:%0q&Ё8sxnna@zdYOM;Ds:^0Tx&N.nȐ=w0mcU`Y?fNDm: M03~&~ۄ~xvAl~ⓡb~őXw~Ne~D~9~0 ~&~u~XJ~$u~x/l(~_ b!~EX~87N~-C~+9~+i/~'&~!H~~~suT~k}%a}ۛ8W}֘2M}ԕC}Ց9s}׎/}׋]&}܈O}ԅK2_vFbl$$eraӌh$WzfjMEmBpB8r-͆u$|xb{D~fu+hk5Xk/`(mMVouLqB:s7цu-Ѕx/$8ze|}&mcso+j+p`rkVtLuAֆwP7x-ӄz$b|Hn}||t%rluYi6Yv{_IZwUS\xK_yAv}z7u{-Ճ|$~ =.{Z"zq{xhM|^3|TJ}Kb}A~,7A~-̃4$WZzR߁3pZgto]džDjTlmJs@ہl7 ,b-w`$iE|yTهp"f:]'r$SJ@k56ق-a$Ӂ0~x{xjoHsdFޛ["rQ܂HÁ ?a^!6΍,-HsAs4jZtia_muXAvO#/wF6y3=zf3燣{+.8|"Ƅ~ڃ\r5]yiqz4`0zW{N|:EƉ|<)}3dž~G+5v~"!%݀vqJh_*W%N5WEg`-d c[seRthJkNA{n8!p0Ns(vk RFy8-|kÝDfjc_hZ.k Rmx A{d?}Oj|lbnaZ,p'QuqI>,sAuf8w60Ey (^oz ׇ[|n~zj raїsY|Pu6Q$voHw@y8bzO0;{({|! ~?i?xaMybXޔz4PzHW{@Y|83}W00~!(~!@^hna~1`j3~XU~PIG@8 :0$( !n!1ZgY_ٔ>Wޒ/O/rG*G?݌"760T(o!{Ȃig#w7_OhWgb6O\iGaq?yI7É0 (?!M*f^ȒVꐨNGƊ?iމ7E/0(\!ȃHf ^GV} 5NF͌4?5[7u/݆(E!ك-l[e~^]בw#V$>NZGF@? /7X$/ˆW(z!ކ}Lb`[@ctS+ f:K9hCmk;nz4(qJ,t%mvy?P|^bnfZehRȞQk"JߛnmUC&ro;lq4tV,v%y{dZ}aŢlVZn/R@oJzqBۗs;&ug4NwP,y?%͋{(=| ~a49rYuMspQqtJvBwu;Gx33z<,{{%}z)~h\`wXxQN8yIzeB@{E;|-3ُ:},Ȍ~&~` _|Xi}P.~Ic~oB~:T3̎g,ԋǀ<&?/$[__$XEPFTI JAғH:ѐPK3J,ߋH&^L T:Ăb^으;WPDnHڔ܆A?:93,vC&t F|iqC^8W3@O喡HAf:.3e5,މ܆7&`H ej؃^+V͘ OHPbA4A:ca3܉x,ىX&憔 }Gł/]Vs1OP`HԐA ^:G]3ulq,Ԉ& C9YfaOQcJflC`Qi<~xk5뛔n/Kq(ݔt"ѐ]wz z*`|X[fQhJSCkC8mRgirvgitFhl?uYnwK q+xc[&|O]`ȥvxc5ifAU]iaQkזYDun?8>q ,\tT !wrD[s^isaytdlug_zvjR xmDy^p7_zs}*{v2}Syo cp-fFqchxFrkkMsmV^suFoQ>vqDx t?7yv*{x<|z̜lRl:mmo?oovpq&j0rDr]st|PuYv&Cvw6xyk*wz2zt{|h it:ku,i|k|tm}Wh@og}[q9~OOs"~eBu~6bv~*lx-z_fphqjnoslf)gXnX[1pLNrNQBFtW6-vW*ox<8 &zϖweg,~iErkYfmhZoz N9qAs5uń*rw `yScHf}hM.qjuel YnvMpAs+5uC*swS yQ:\c ͈eK|gqice2k/YqnM_pWAVrD5tЈ*sv y9lbY.d|fpji$dk\&Ym?M oّ=Ar'(5to*sv xƅaĩ]d{f^ohKd2jXm"3Lor@qː5yt!*svgB xmxZϊnx^<~]yFar)ydez\gYzjM${m@|ep4>}+sq(Z}vA~y9uwcv8e|vh#pwjdxlXynoXLmzLq@{4t4|!v](h}x"~ zrk5sl{ptnoupscvr4WwsKyu?zwu3{1y-(t|Bzj}T|qgprqt zFsu3ntDvUbunwwW?vxKMwy?_yz3zZ{({||}ݏnz|p+{yq{mr|bt(|Vuu}'Jv}?x<~3y~(z~| IimG(nɁwpFlqas&Ut~J3v[>w23ox(zM0{k0mvo*kp`]rBeU-sŅIuP>Pv݄(3Gxab(y΂j{,jӐml)un:jo㌌_q}:TsIMt>vK3!w߅(y`Pz͂iku mzj,o/_pؐ$T,r}.Ht#!=uʊ2wk(xz} iIGkLtplܙink^pOSqDHs=u]2w (xNz\ySyz@xJz΋@|{_z6{-|x[%|}bx wnw8ex|\ySyIzT@Cz팅6{Q-|+%|!}Hwavߝniwhe[wz\%xRyFIy@z<6{'q-{%$|X(#|߄xC[:o@^eÉa\"dRuhH+k">`n!4q+ot,"hFwDփzrw]b3n*ddԇg[E&jQklHQo#>q4̄jt++|v"GyH8{v hlkc̆m#ZozoQqGńNs>/u 4Mw"+y+"΂e{,}4tхokq0bYrYt*P`suGBw!=ڂx4Kz+{y"|فO~gs̓v0jXw=bxv}O46~\FV~=8'40+~#>DPm q+iI܂`WNSvE%Z<04 +#Zq$hS_W"0NLEr<m33ly+~_#o<2pGQg_N~V~M~㊹EY~܉<~A3~+n~#}~τ} ~qo~g8~oW^~UVD~MYM~UE~`zb-{Z|*QԆ|I}]A}98D~1 )3!6LimPagYQ`Ɂ%I7?A@/X9 a0߁i);2{!ցshH`߆m2XP酁H/Av8߂ل80قD) )/" (kf_RP^WOH!n@r58wi0މ))T"!ӆWje []˗_4Uٕrb\MɓtejEƑkh=dk5э~n-ċq&.u x/NV{Fdb%]+ldUHhguMCjEWl=oX5r-ƊWt&Ww\Sya|dh2\Sj^TlLnD_MqbFe?`Eh8ml1JoC*Krr#"uxt{[brL*a=u#w؈zdx|[OgT)j)LlVEΕmn>Γp8r1-Ju@*sw$ y{h}ZmSto[LoqEer>|t7؏Tv\1x(*y$I{Y}k~YTsRtuLuEw> \{7;|1 $}*~$aӅ&/RpX}zR)~Kaq~D|~=t[7e1\1*Y$ÆdbہXQʓKwDU=7i1*ć$߅‚1|˂\}X"bQn6JD=Ȇ7Nᅫ0*ɇ$+SuWӌ0QJzC=jE76@i0Za*͆uN%No c WLPđJ@CFU=L7"0Y*І%Bh>U S]LF_EBb?e8ěi2Ř+j8l2o,̓ar';up!$x8ozv|}'RD_gKiiEql>ynC8Qp2r,ڑuY'+w!֋z!|Cц~5Qˢm=K,nDp>qrc8ct>2v,ߐx'Iz" {5}(QKr_JԞ5sD|ct>Fvc8Kw2y?,z'p|7"B}A\~oQ wmJx9DR#y>)ez#8>{)2|3- }?'~I"~"F-_PŞ[|.Jk|D. }>c}84~O2~- 'Ë,"f…HŁPu4J.D=i,8$i2-/ 'X"ۇ&UK9CpP4%I晖C̖=͔n8 ˄2 b-5]'"΃;iՃOț/I C=7o2k-8.(j#?] |O7IsӌCtc=7a2ى-;-(#1Z4bNVdZf^@haqjecm-h_Uo}kGqn9tHq,]vt y=w^=`acce~f#hp8hkbk"mTmp'Fpar9hs u,/uwD 9xWyZi-]kC:`mI|co7ofq aiJrSl#tFRovd9qx,ty Ww{^Wq&[Ss<^t{xaundv`gwS?jyEmz8p{+s| rv}UkzY{l\{zL_|mc|_fP|Ri}VEXl}8io~+s"~[ vB~1S\%WH$Zy/^eJl#aʂ _1e1R hDk48?oF+r uЀ9QBUFYQx8]ckS`q^d3zQgDk,8n+r!CupP"XT\X[w]\wj_]cS(Q%f~Dfj8n&,q!}u✊N=SJ7W_v[i^ג;]|bPf?D9i!7m,qGY!tڃN RorkCtn6vq*Extzwd'_fSbyhreZwj~hjlj]nm\PupoCYs'rv6utt*.wwPyyv`h.crjdelv;h2niijpo\lrZOoVt=Bqv6Ct\w*vyNy6{r^p$`rcsuf(thnhv[kOwCOmxyB^py5s`z*u{vx}[x^yTazhsdnzg~g.{["i|Nl|Ao},5r}*u?~#w~Y\]*`/rc feZohNk܀An׀5q̀h*tC ww)XɊ.[-~'^ˇra͆edچYgDMkAXn5q.**t*6 JwwVZ8I}:]q:`e2c,YOgM-jDSAmu5upp*;s vUy"Y,N|^\op_ےidc]XfUJLi/@l 5lp&*Ls[ vsTPXT.{[ߚo_ dbfXX{eLi@ld5fo#*\s S v8>SW{ [9oe^Oca֙X-e/Lhh@k5aok*hrˈ v X-mVoZd~qp_^rqaerdYetJh;Luk|@-wtn3yq(-zt|x#)jI_ kb |mdpo4gdpjZXtrqmLt9o?vrL3wt(,ywZ {y@g&gQZi)i{qkko{mmc|noWpqKjrs?Atu3|vw(,xyIz{d]otfpz)hrtncksbmu3Vo7vJqqw>sy=3Kuz(,x{z+}bw[{dx=xgymXiZyakzV"m{;JNpN{>r|3&u }I(8wa}y~`.~0b,we^l`h{`jmU}lIo^>:q3 th(Ovy>^jaxvdAkfЅ `+i]TkIjnr=q.2sǂU(bvFVxL]'́`7ucjeNJ_hpqTskIImЇ=p2s;(tuԃxOt$\/_5u2b+j!d-_giT j`Hm)=o2r (ur7xvB[<(l^btabid/^f+SiÐHlB=wo}2rY+(u"wńP|Z~]^t`i c^2flSliBH[l)`=\o/2r(t wqtVtZ[vfu^ jvav_`w^dSxJh+H+yUkoR=tqWFvlsn;wu0yxw&PzyS|f{ejn:}llorunq}g}p=r\xqtpQsnuFquw^;Zvx0xzB&bz*{{}hu|&jvqZlwfnx[pbyPr'zbEt{8;u| 0w|&yyv}{!~zf|zi;}kpGka}emQ~Zo7~YPXq~Es~:u !0~wb&x.z^eVygɃoZjdl'ZZ>n.Op4E'rB_:tT0mv^&xSioz-#Ed'xfbnhd#k%YmGO_ogDq:ds0^uу&w߃y΂?Sbxemh tcjIY3ltOnDp^:=s$0RuV0&w|y6bwad m9gF$c iXkڐNn"D^ph:rm0Ht4&w+ y>aTyvdlfxbhX|kR#NzmmD3o:rN0@t&v5y zeVyzZoni{/^c{}avY{dN|Xh4C|k|8}n.2~-r $6~uLxw;^KwxaWmxdFbyZg XziMzlC{qoU8_|;r.'} t$`}w~zEWtSevuth+kvzjuawYlW+x~oy4@rF+u"w2mzwoze5m{mgd{j'Z|Fl]Qb|nG}p>N}s4~u_+~w"y| vxllyBncyoZ.zwqP{ sSGz{u=|Kv4|x`+}z"~M{~}jtvrkwbtabx*uYlxvPywFzay={.z34i|{P+||r#}}"~E~stysjuzYav{ Xw{Ox|SFyW|=Wz?}4B{-~+|~#D|Wo}rsQj tp6aukXvzOw|F%xn=yn4!zs+{p#d|\}5qr@i@sB`utoWu:NvEwGg{"ndeꁫgH])1z!cA{h}lO}qd}sE[}tS~uJ~Gw;B=~tx9~y1D~{ )?A|R!}U~kx{wc9|-xZ|yR|zJ}{fA}d|.9y}|1/~#})L~~z!~H jzU~ buz~ZM{H~R{#I|eA|v9I|1}g+)W}ۀu!~A~iyayYz4QzIX{-bAU{#9|11 |)_}H\"},~-i xa+xoY;yHQ+yЈ.I z`oAz8{0|-)b|Ą8"}RxI}ςhhw `wێXxPyHyD@z`8{ 0{>)c|V"0|o}{gvf `/w0Xtw"PxtsHy)@y8z0{M,)e{P"A|}EgW_݌[)W^ObGKhe{?;Yh6чglT.|o&s/EvQIz%g]_=`V[cN؈tfFi>͆l6o.p*r&ÄyuxR{e鈥d<^fV.PiHN.kF1n >e%p6Wr.dun&bwzax|dنpjr]1lUqfnMplEFrV>tG6Av3.Xx#&iz | R}czp\mr/TȃsLLuE;v=vw5y`.Pz'|: 'D}cGv[ƂwT5NxLyDၯz=q_{u5΁%|c.L}R'.~F Z=e+br\|=[!:|S}]L$}D~I=:k~5K4.H5'C$ .܁$a"ZSAKׂDP=  5.C'S vfga&KZ RKx~aD~<~݅f5~.<~=']~ *`~ Y~9Rr~>]K4~&uC~/<~B5m~Ys.6~pS'e~> ~9~Y`2}OY2}R%}J}(C}<}ŋT5]}牿.1~ 'k~+ ~T~u^WW[P47_ HbAGe: Zil2l+3qpQ$M s҆w=z^?]Vda!Od,H7g@ߌj9m 2mQp +<s$zvy {]^dV02fNi5Gk@xan9yp2Ks'+Au$xGXzd}\_iUv3lN]n4G.p+@r)9/t02&v:+CxG$ĄzQ|I~%[|oTЊoqsMՉisFot?pv"8sw2y9+Lz$ꃸ|QȂ}38[u=TEvMewFi$x?~@y8Ѕ\z2|+Z}'%~;/GHBZmczSć{wM|7F|?H6}s8j~1~+gW%175+Y܇/SOoOLEڄ?C8,1T+p8z%L_€Ym&RjLNE>b8xȄR1,+w%bBX)RLۉQEb/>Ƃ8c@1ށk+}%t%ʃ9X?R+K*'E6>8Q1؁+5%'ӄ5VXSOwS[H͖_{B b;efV4ni.uTmb(Gp"$EthRwzU^O a:HidJAg<;&j>4ڎmO.rph(5s"\v͇+y}~|5TcNpfzG撶iAXk:n4p.jFs[(L|v"x%{҄}UTYpi`MkGlm@1o:sq4t.\vB(]Pxo"zK>|~YSnM[pG Drx@t:hu4jpwd.[y(w@z"|mh}i<\StLguFv@s`x:EyE4]Wz.e{(Q}#~6̃SVRy LzF{{ @B={:'|4Rd}m.n~>( #H.1R@Q}LE~F:1@,: 4GR.u!(̄Ł #n^3o1~QFK׃$Eu[?&U9M4;E.z\)(#\`Q;uK߇tEH?E9ԇs40.o(}#f6}Q>K[vE͊?9q?4(]h..f)X#ÁU-ZzMGXG^\=A_;!c5Xf/ٔj=*Zm% -q xuAxP{YL^_F̝aH@(d=:gA5Ij[/m*xIp%@)h:̖k]52n/`p*s%eBvT xۇ{hL}K֛hEk@>XmJ:ow5pq/ԏs*uvB% x z|~KZ$nEo@q:mbsq4u;/Վw *Cx%z |^~1~JsEhotj?Eu:X w,4x/升y*Ћ6{n%|!<~1 _0jJwE=x?ēy:Gz4{/|*O}&~!s^r7J|;E|?}:1~+4~/j+t&:S!gƁfJZD⒰?wu:4㌯/*+S&^n!ӄG@فJD?Q94؋τ0턴+-m&|!4mσTIy.Dx?3W94ϋl0I+:S<&k}"Äu[kP]R `qVBbZYwSeN^9jga]jEeOli0Bol6rp2)uwsnx[vɝYK[b\g^_haub?dheg\gjO kmB-np5q?sV)tTuwhxUQdGXfԁG\RiGt_xkgbm[epNPi;r'AltG5Wpvd)sLxhvzyQltUnYpsso]rf`sZWduMgvxA(kDw5nyW)kr_z=u|"HOusS>v~W?w|r\ZxVe^y&YbyM'fMz@j{~4m|C)sq}u7}̕L}Q}}|Uj~/qYYN~_e]@~Xa<~Le5~@i0~4m')q=thoJvpODC|vSńpyWلKdd[Xn`;LNd?@Oh_-4l~)pB .tgדEHnMz{R[[oV-cZڈW_#Lce@-gd4k<)p+ rtXGb.LmzQ0oU cGY6W^LZKb~@%g4kb)o sԃ:FOKdxzBP7$nTbY#2W`]Kb *@$f}4j*!oa s+ExgJ yOknSbXW)]Kau@#fC5 j*ppt3 ssW'vgvyxߒ`[Tc~j^Yfzra;hnocjbgfmEVi{oJclqq>]ozt2rvK'uhxk&xBzXkԄ[mmy!^omYaq6a~drUgtkIju=n/w2qly#'tzTw|.U4syXu7w\fvZlT_wQ`bxAUf0y0ILiz=m{2kp}{'s|v}ƍR{‚CV|SvZ|ke]}_an}nT|d}Hh~ =il$~V2do~'s(~vuSYPԃn0URuXj\_4`0uScHg=8kUv2^o )( rDv9O!:Sw9u#Wei[On^_vSb|HFf…=j2dnu(0r0u@ME]R/teViiHZD^-^'{S?bHfD=i2ym(Uq̈́zusyL~Q%sUvhYeu]]^BRa_ Geh=ix2m9(uq{u9K~PPsDTBh`Xw]~\R`˒Gd= i 2m+(q9I u iERDjVfv lrZejhm^-^oaSMqUeGsGi1;u]l0w{p^%ys{wFe/ZgF^tiMaw40 t x%vzoy2|9[r{^spaufdxv9[gIwMPTj&xaEPm yt:gp&z/s{&u|x}LqnBsq!7us-wv $@yxlO{z`ditg=kjim`SkoV mq_Kos2Aru7\tdv-vx$Yxzzz|D~b&q2sdrigts_uiu*USlv`K^niwA4px7)sOz -u{H$~x|z'}|_xErbyhey^h;ztTj{Jm6{@o|j7r_}-t}$w^~y?y){^zRiQ4{gl+H|p"D}t6~wyuqZ5ozs&]etP`[uJcQvZfHAwwj >^xm"4yp?+D{Osa"t|vo}ywnzan p(dFdKqfZsi\QtWkGun_=w-p4Xxsw+@z6v"{xx}{vkyhlm{jc]oQlYpnPSr{pGtr=ut4(wv+=y:x"zz~|\|guMhokk5qabwmCrYot0OpuFrv=8txC4vsy+ExR{ "z|o{}t7fvjiQwakxjX[my:O#oz F"quzf-~`DhBW@kNBm>E|o{hf :}i1~nmZ(q txppx(Zgx]^y`UtzcLdzg C{gj1:l|,mW1q}p(}s ~vYyota%frvc]vwfTwi0KxkBynS: zp1G{s(|v?!}x~{kn9r"gelszj<\tllSunlKvpmB{xru9yIt~1&zv){x!F|z~|m onduqFpd[rr S"tsJ~uWtBvvx9x w1yvyz)z{!x|)|Q}\~lmtcolv>[q w_RrxRJsyFAutz?9Ov{=1x|A),z}H!{z~P|Okk{Obm{Zxo|Rq4|Ir}bAttg}9%v ~R0w~)CyR^!z|MqjPjUb#l]YnEQpIJq{A8syj9u;a0v^)Vx`"zde${piiak)BYlm&Q:n8Ip̅A r8tz0vb)hx4V"&yV{Ni gsa j)Yl5Pn Hp@qw8sY0u8)xwɅ"By{Chzg`iXXkpFPmQHo[@qp8sz0u{:)wr"XyZ{ i|S_`W\X[:P!t^GOb?t>fT6Kj.nm&q?uAD(xhG~Z_~]tW`OEcF;g>jjJ6m.np&Zt }wE+zsg{`^|!cV|fSN|hF\}Kk>m}n:6O~,p.W~s&7vry(M{exg(]yiUzXkMzmE{p> |r+6|tT.E}v&~4x~zG}dvm]wogUEx`q+MKy$rEeyt_=zv5{w.?|jyK&}Gz ~|~~?dts\butTvv{ |-}b|qRn[rSsLu#DpvN?=wzg5x.Hy'X{ |H8g}MpapZq~S6rڄKtD9uX2abn튬Z$p|0Rq艎Kxs'D tWQL[gIv_BUb:3f30jW+On$q탸uy{_EYX`]XPք`ILcAȃg:z\ja2m+q$t]0wz^R`HWOc(P3eHhAJk]: n#2ȁp+s$Ӂvkyu[|#]fkVhO~k/H#me@܀o9Ҁq2*t/+Nv$yx{}J]}ql~V}nnN~ pIG~9r@~ls9~u2~wV+6y%%z|+~r\T{xrFUj{sNl|euGK|vb@<}w9j}gx2w}zP+~?{%@~}$~VB[ywTzexMzyF{fz?{{`9E|S|82k|}+}j}%d}~K~ZxL}cTQy}My~]Fz3~?z9'{^r2c|+|B%}Wx}~pZgwSwЂM;xFoy?yʂ9z2_{E+| %|̂m}J~,0Yu߇S}vLJLwlF;x-?xY8y˅2[z;+{%|X})[}݂Yt S.uHLvƋoFwkw?fxG8y62Yz%}+{g%{S|܄>7}UX[%T-Q{XJ[Ce_<؊=c_6-&g,/^!j(*n"Drtv\yWZPՋ]J `C;d+w>yJ>{}Ej @0l[;n6p1ٌ(r-2t(w<$ yt΅{Z}Y`[~E n@`lp;r6Ft]1ފv-J:w(y$O{ }4ك~Dݏ1s@=u;sv6w1≁y:-_ z(| $}q P~Dčx@ ny>;lz[6{T1W|R-r}R)~V$@N )QE'pDb|_@}`;O~96f~14{-)($x/ ÂpV+D?߉V;66T)19l--)H%΂ O|ԂDE?ۄ;"6tv1m-w)aW%5FO!rрehYVM[Q{i^(V5n`Zubc^VjfbJ"if>mFj2Tpn'>tr'wwuTV҅VZLyZ ]m]]a"a``d~UgdgIVgk)=okqnf1o1q'(rtvvwҏOd_RbSx'VdelBZg`U]jXTalHeo]vGbTx<=fy91Wkzt'o{ft*}:Dx[IytN.yicRzI]W~zR\K{tGRa|<e|1ej};'Wo\}s~Bc~GSsL8hQ ]_VRD[G `;e 1rj'n*s^@N}EmrJugO\T QYRF_;dC1ihU'nfvsc>}/C׍r\IgsN`p\SQYF^Ls<c"1h݄'nrςo=1K|BqGg M_\?RΎQX?F]<=c 2hi(.m?ry<*|FA~q}FmfL\RMQWF]1kM(|aRWpW !M\ qC\a9[f /k \&oՄt=9aB1JudG0k_L2aHQ9W=VNRMg[kC^`9se{/j6&o.tgdtN'xeeRRmugVybiZWk^M!mbB@pEf7rj-Aun#xMrzvu_VxvaYl&c]MawfR`VhdLakegAnAj7 qDnW-tDq#w#tyxB[F^ub]aAj`~c`jcPfUf8iKi4lCA)lio6oq,st#vw?-yy~OWwfRt Zihqi]rj_r`lU%cnKg7sf49uj*x,n!z_r|yvy;eVQogYdif][kQ`Q(m^cGogj=qj3tXnL*vq"y9u{zxxwa^mc`cfcYhyfMP@jiFmgk=pn3rq*ut"Bx2wMZzzv]eplS`gbc/iYekOhn*F1kp]ky3FoJ{*r|0"u}Z]x~{rUziuYQz`=\{?W `;{Mc|2Eg=|<j}A3Gn`}*q~|#u<#xAqS(hW_[V^ŀMbtDf)<i—3Qm+q@#Etwq/Rp#vt\Z*wpP׍gT^X~U\^bM2`a=Ddp ;hw3zlt+dpU#t XwWpCOgKSB^tWqU[wM _Dc̋c;g3l +pw#sȄ}w$lrxp,Ohq>R_+rGVUsDZLt{^Cuc:GwZg1yk(jzo* b|zs'~w pkV[g7mtY]n\Tpa`rKqcBsg`9uj0wtna(nyiq {Tu`7}xo%h ]ei`X\kcSmeJohBqk9Asn0vq(qx7t zNww|8zQmdddff[hiRk;kZJmmAoo8r?rG0ptt(sw$w ygyl{r{lakcdmjwg6y k'.zn&c|rWE}|u~yPgYnT][^o`&VHqbNreEth=uk5w\n-yq&qztz|sw}zf3k d ]lf\UnfhMQp0k EArmk=rso5ur@-wt&~yw<{y6}&|ehj\jliTlnALnpDp(q=$rBs5]tmu-vw&xyz{|x}ed:ep\6gr&T;is{LHlFtDynv$r%{-t|'w} fyb~/{kba}Zd}FSFf}Ki<}Ck~)yZr2+;zt$|/wgr}y~|f]rniV"p9kNqmGks/oz@.tqr97vTsp2'wu{+Gyw${-y|{}}\lxo}Uwn qNKorG qhs?s*uw9tv2#vx+cxz4%zF{{}f:}e~[jiuYTlvRMmwKFoxD?qyH8szV2u{x+|w|%8y}4{R~|[[h{Tljo{MwlY| Fqnh|?p}8r}2 t~T+v%dxizˀP|uZgShM jF;m?coZ8q2(s<+v*i%xQzZ|ZgeSgLiɅ_Fk?Kn^8p΄<21s>+u%w7y{͂eZ#dw:SYf]Lh҉~Ek?7m8p" 27rA+u/t%wy>{Y߂P)RT KU6XD[\ =X`6d5/hV(Ձl"*p~t xXV_QYJ]3C`<Md^6&g/fk(րVoi"s%LvgzCW{\P{_I|)bC|e<\}h5}k/B~Fn(~r3"up&=x{VxvbP*xe2IvygBzGjI<{l5{o}/+|r+(}t"~qw[Mz< |UuhOvjjHwClBOx:n;y=p5zDs/%{RuN(|bw#(}my~s{PU}U/sTn6NtEoHuNqBvvs);wt5ixv/,zxB){Pz #d|{}}z~TqEsNr_tH5svAtw=;ivExr5Uwy/3y{);ze|Z#{} }~~. TCo{y'NpyGrzAsz{N;Iu|5Iv|/=x})Zy~#{vU|:%}Sm~YMo<~Gp)Aar'o;3s5Eu/Lw<)zx#z;|wW}[SklMfmGZoqxA>qQ;"rу75Ct#/Zv)xZ$z{} TS1kqM,lG)nz^A"p;rI5Bs/euJ)w愾$5y${dp|͂QɉBPKT`TDX>\8g`2Vd,;*i&SmK τoqy5u y]PV|JZDfy]>7a58d2!h,,NlB&hp !sނwYzP0\aI_Cꁠb=́e7h1l, o^&zr!.uy 9{O,1b.I[dCug=nKj;7~l1o,rn&Nu?!VwSz~D|N}|wgH|j&C|lk=$}Dn7N}p1~;s,~ui&w!z|&ʀ~MzmHcztoBzp<{r71|(tz1|vO,5}jx5&}z!~{M}+M}xrOH xsB{y5u:ÌY,93]D3ag.Ve)xi$rn=r8v*(yI8VCËZ9>b]8a3!eF.N\i)#l$(px tjw~{Ho\CE_p>+b8e3Vi.Ajlf)/o$I6s5vz.gyzɃ%|3G aBJd=gn8]Pj&3%l.,o)3Cr$euقxffmz U};G#afBIi=Pyl8(LnM3 0p.*s)Ju$w {zL|gU~FFkAn7=pL8 r13t$.7v )nx.$ɀz6 [|}LFn~pA~r<~t]7~u2-wh.Cnx)z$|@ }4 \1F}:uA}8w<}Lxf7}}y2}z.R~I{)~}%+~~B ~Tmz5E{zSAJ{{<{|~7|}C2|~.g}1~)}%a}J!~_~KO{Ezh~Azla.e*Ti}&(ml!RqSu xg{k@zS[t;.u79Ew-3x.ay*"{N'|#?~~Fʀ4π>Ղx^;Ay7+{ 3D|.}+~'H#D€̀E8܀e>>|;}7q~3 k/+='v́D# ւ(? ;V7a3 [/+U8' !# 2 ,!#~ ˂mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~D"LkHRSRSTU~V{WyYvZt\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\=9",77RCiMzNMLL}NxOuPrQpSnUlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlW8!/:K3QMT`RjSqVsKOXdmrȩpΟoӕn׎pٌwڌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}>K2PMQ\PdPgFxJOZemlǟk̗kАkӊnՈsֈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈy?J2OLNVLYFbD|JQ\ggfÕfȏfˉg΅jЃoЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃs@J1MIJLFJ?hELT_`aaaÇbƂcf~j}n}n}n}n}n}n}n}n}n}n}n}n}n}n}nBH0I?C;8P@kHPXXYZ[\]{_yawewhwhwhwhwhwhwhwhwhwhwhwhwhwhwhCG.A/189UCmLTRQST~UzVwXtZr\q_pbpbpbpbpbpbpbpbpbpbpbpbpbpbpbAA$+ 2=SEkL~SWVWXZ|[x^uasesjsqssssssssssssssssssssssssss9I(F.=%7>>XGmO~SQPRSyUuWrYo\n_mdlilklklklklklklklklklklklklk;F#<-(8CAZJmN{LLL|MvOqQnRkUiWhZg^fbfcfcfcfcfcfcfcfcfcfcfcfcfc>< 1.:EEYIjGwGG{HsHmJiLfNePcRbUaX`[`]`]`]`]`]`]`]`]`]`]`]`]`]= '40>DBVAeAqAzyBqCjEfFbH`J^L]N\P[RZUZVZVZVZVZVZVZVZVZVZVZVZVZV! ,70;A:P:^;hxOUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWe^sdimpu{ㅁ}yxxz{σ˅˅˅˅˅˅˅˅˅˅˅˅*9&D=OUWd^qd~impsz㋀|yz{τȇÇÇÇÇÇÇÇÇÇÇÇÇ*9&D=OUWc^pe}hlqsx~ހ{{}ЃȈ˽˽˽˽˽˽˽˽˽˽˽˽*9&D=OUWb_oc{fjosv}Ꮓޅ}}ҁȆͺͷͷͷͷͷͷͷͷͷͷͷͷ+9&D=OTWa_mbyeimquz◂ٍЃˁɃкϴбббббббббббб+9&D=OSX`^l`xcgkosyݠєNJҾҸҳҮҬҬҬҬҬҬҬҬҬҬҬҬ+9&E=OSX_]k_vbeinsy֥~˛ͷӳ԰Ԭԩԧӧӧӧӧӧӧӧӧӧӧӧ+:%E=ORX^\j^uICC_PROFILE `dinsݳvѪ{šù̯ө֧֤֢աաաաաաաաաաաա+:%E=OQX][h]s`}dhnpظr̯x~ǫ́ԟ؜؛؛כ֛֛֛֛֛֛֛֛֛֛֛+:%E=OQX\Zg\q_zcholҽpƵv{­ˡӕِڑڒٔؔؔؔؔؔؔؔؔؔؔؔ+:%E=OPX[Ye[o^wb~hkhmsx}ʚӌن܆ۊڌٌٌٌٌٌٌٌٌٌٌٌ+:%E=OOWYXcZl]sbxi{eejptyɒ}҅ڀن؇؇؇؇؇؇؇؇؇؇؇؇+:%E=OMUWW`Yh\nbqex^bglptȊx~{zՃԃՃՃՃՃՃՃՃՃՃՃՃ,;%E"L2J3E.=;DSIhOzUVTVW{Yu\q`oenknso|oӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂ/?"I)C%3'yf@}aB]DZFYHWJVLVNUQTTTVTVTVTVTVTVTVTVTVTVTVTV*2!121@3M}4Xt6ak8hd:n^tW@vUBwTDxSFyRHzQIzPLzPN{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmt{{tonnnopqux{{{{{{{{{{{"1 >6ILQZWg]tchlryyspopqruy}~~~~~~~~~~~"1 >6ILQYWf]rb~glpw~wrpqruy}ŀŀŀŀŀŀŀŀŀŀŀ# 2 >6IKPWWd]pb|gkou||tqrsx}ʀÁ# 2 >6IJPVWb]nbzgkns{炃ytuw{Â# 2 >6IJPUWa^lcxgknrzኁـyxz}¼¶²òòòòòòòòòò# 2>6IIPTW_^kbufjosyے҇|}źĵİŭŭŭŭŭŭŭŭŭŭŭ# 2>6IHPSX^^iase}inrߣy՘~ˎ»ǸǷDzǮǪǨǨǨǨǨǨǨǨǨǨǨ# 2>6IGPRX\]g`qdzhmrڨvО|ŕ²Ȯʬʪʧɤɢɢɢɢɢɢɢɢɢɢɢ# 2>6IFPPY[\e_ncwgloլsʤyɥ̢̡̟̝˜˜˜˜˜˜˜˜˜˜˜# 3>5HEQOYY\c_kbsgzl۹kбqũw|ɛΘϖϖΖ͖̖̖̖̖̖̖̖̖̖̖# 3>5HDQNXW[`^hbogth־h˶ntz~ɒύыьэώΎΎΎΎΎΎΎΎΎΎ# 3>5HCRLXUZ]]daigmbfŻlqv{ȉςӀ҂҅Їχχχχχχχχχχ# 3?5HBSJWRYY\_`bck]~cinsw{ǂ{y{πππππππππππ# 3?5I@THUOWTZXaX[jZ}afkosv{|utt{|||||||||||$ 3?5J>SETJUNYN]QWhY{]bgjm~qtxppovxxxxxxxxxxx$ 4?5K9)B@HUMgRvPPP{QsSlWg[ebdidpeyeۃfیfیfیfیfیfیfیfیfیfیfی& 8F;-:0BEHXMiKwKK|LsMlPgSdWb]abahaoaxaaaaaaaaaaa':;  1;5CHHZFiFuF|GsHkJeLbO_S^W]\\a\f\m\t\t\t\t\t\t\t\t\t\t\t(:$4#>8AI@Y@fAq|BzsCkDeF`I]L[OYSXVXZW^WdWiWiWiWiWiWiWiWiWiWiWi'+7&;89G9U;a{JGQQX\^fcpgzkpޖxՋ~́zxyz| +8/B=JFROYY_cdlhvlp؛vϒ|ň||~ +8/BVDXJZP^S_^]qʻdjpuy~}{}ǀƂłłłłłłłłł +8.C5N -% 6@3FEGVEeEqF{wGmIeK_O\TZZYaXhXpXxY悖Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕./+9$A7BG@W@dAoxBxnCfE`H[LYPWUVZU`UfTlTuT|T|T|T|T|T|T|T|T|T|!0<';89G9U;`wqf@x_B|ZEWHULSPRTQYQ]PbPiOoOoOoOoOoOoOoOoOoOo  & 13(272D4Pv6Zm8ce:i^\F@]EC^DF^CH^BK^AN^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #~2*z?=FHMTS`~Ylw`wpjisb|][Z[[\]^Ėbǖeɖh̕kϔlѕlѕlѕlѕlѕlѕlѕlѕlѕ #2*~>;EEKPQ\Wh]s{d~smkwc_]]^_`œeśițl̚oϚpΛq͜q͜q͜q͜q͜q͜q͜q͜q͜ #2*=9DCKNQZWe]qb|ykptg~a__`bdhƝlʝo͜q̝r̞s˟s˟s˟s˟s˟s˟s˟s˟s˟ #2*<8CBKLQWWc]nbyiwrn{fccefhkȟo˟r˟sʠuʡuɢuɢuɢuɢuɢuɢuɢuɢuɢ #2)<7D@LJRUX`]kbvg~puymhhijkmɢrɢuɢvȣwǤwǤwǤwǤwǤwǤwǤwǤwǤwǤ$2);5D>LHRRX]]hbrg}o~wunllnopĦtƦwƦxƦyŧyŧyŧyŧyŧyŧyŧyŧyŧyŧ$2);4E=LFSOXY]dbngyn݇w}}uqpqstvĩyĩzĩ{ê{ê{ê{ê{ê{ê{ê{ê{ê{ê$2);3E;MCSLYV^`bjgtߘo~֎u΅{|vtuvwy¬{¬|¬}}¬}¬}¬}¬}¬}¬}¬}¬}¬$2)<1E9MATIZR_[cegnڝl|єsȌy~|yyz{|~~$2)<0F7N?TGZN`Wd_ުfjբjz̚qÒw|~}}~$1(&H)Q,Q,S+K8OMW`]qchlptvymkjjmoppppppppp%2 >#I%N%N$O D6MKT^Zo`~dhlzoouhgffgklllllllll%3>J JH@D4KHQ\Wm\|`c}fqjhqc}bbaa«f¬ggggggggg%3?ID? DJ1MEOYSjWyZ]t`idam_{^Nj]ɜ]ʬ\¤`ǤbƦbƦbƦbƦbƦbƦbƦbƦbƦ%3?B8 7C!L3QETVRgSvUvWjY`_\jZyZوYڙYܩYݽ[͜\̝\̝\̝\̝\̝\̝\̝\̝\̝&3? 5&8C(J:NKN[MjMwxNlOaRZYWdVrV倘W掖W睕W笔WX˓X˓X˓X˓X˓X˓X˓X˓X˓% 1 6+ :C.I?HPH_Gk{HvoHdJ]OXUU^ThTtTTꋐT똏T릍T챍T챍T챍T챍T챍T챍T챍T챍T챍#* 0mUAqQEtOIuMNvLSwKXwJ]wIcvIjvHruGxuGxuGxuGxuGxuGxuGxuGxuGxuֱ# )+',4|-?q/Jh1R_4YY7_T:cP=fMAhKEjJIjHMkGQkFUkEZkD_kCejCjjCjjCjjCjjCjjCjjCjjCjjCjj̼ ##{$/o&9f)B^,IW/OR2SM5WK9YH<[G?\EC]DF^BJ^AM^@Q^?U^>Z^>]^>]^>]^>]^>]^>]^>]^>]^>]^ yn'd0["8U&>O)CK,FG0IE3KC6LA9M??O=BO{GIyNUuUam]lfgv^q~W{TRRRRSSŇẆ[φ^҆bՅdمf܆f܆f܆f܆f܆f܆f܆f܆f܆x tq-%u83|?=FG~MSzT^s[jkdtcn}[yVSSTUVWÊZ͉^Љbӈe׈gڈhۉhۊhۊhۊhۊhۊhۊhۊhۊy ur-%y71>;FEMPS\yZgqbril|`vZWWWYZ[]͋aыeՊhيiڋjٌk؍k؍k؍k؍k؍k؍k؍k؍y vs-%|60>9FCMNSYYex`ppizgs`}\[\]^`aˍeӍh׌j؎k֏m֐mՐmՐmՐmՐmՐmՐmՐmՐz xu-%5.?7FAMKSVYa_lwgwnpfza_`acdeɐgԐk֐mՑnԓoӔpӔpӔpӔpӔpӔpӔpӔpӔ{ yv-$5-?5G>MHSRY]^i~etwn~nwhddefghĕjҔnҔpҕqіrїrїrїrїrїrїrїrїrї| zx,#5+?3G;NESNYY^ddomzxuo}jhijklmϙpЙrϙsϚtΚuΚuΚuΚuΚuΚuΚuΚuΚ} {{+"5)?1G9NATJYT^_cj݉luրswzpmmnopqȜs͜u͝v̝w̝w̝w̝w̝w̝w̝w̝w̝w̝} {}*!6(?/G6N>TFYO^YddؐkrЇqxw~sqrstuvʠxʠxʠyʠyʠyʠyʠyʠyʠyʠyʠyʠ~ |* 6&@-G3N;TBYJ^Sܞc`Ӗipʎo~†u{yvvvwxyȣzȣ{ȣ{ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ }*6%@+H1N7T>YE^Lآ`^Λhnœn}sy{yz{{|Ƨ}Ƨ}Ʀ}Ʀ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ ~*6#@(H.O4U9Z?ݭZIӧ^\ʠfml{rw|}}~~ªĪĩŨŨŨŨŨŨŨŨŨ~*6!@&H+O0U4Y8ٱUHϪ\[Ťdkjypuy¬êêêêêêêêê*6 @$H(O+U.V2մRFˮ[Ybihxnsw|~¬¬¬¬¬¬¬¬*6@!H$P&R(ܼO1ѸQDdzYW`hfvlquy~zwvttvyzzzzzzzz*6@H O O F/ͽOC·WU^fduinrv{zrnmllnqrrrrrrrr*6@HKID-MAUS[dasfkostwkhggfi¬k¬k¬k¬k¬k¬k¬k¬k¬k¬*6?HE9B*K>RQYb^pc}gjxnmsf}ccbbeƦfŨgŨgŨgŨgŨgŨgŨgŨgŨ*5?B ;3?(H;ONU_Zn^{b{fpifpa{__^^`ˠbɢbɢbɢbɢbɢbɢbɢbɢbɢ*4 = 7!4>$E8LKR\VkZx~]r`gd_l\x[[ZYºZИ]Ϛ]Λ]Λ]Λ]Λ]Λ]Λ]Λ]Λ ) 26);E!I5JGNXQgTttViY__ZhXvWυVЕVҦUӸUҏWՐXՑXՑXՑXՑXՑXՑXՑXՑ&*.=F&J8JHKWLevNqkP|`SYZVeUsTT⑈T㠇S䰆SŅS؅SچSچSچSچSچSچSچSچ3 ?C-D=EKEYxFelGpaIxYMSTP^NiMwLLKKJ}K}K}K}K}K}K}K}K}ٸ'5;!=1>@?Mz@Yn@dcBlZDsSHxOO{LW|K`|Ik|Hv{HzGyGxFwFwFwFwFwFwFwFwFw ٮξ( 15%738@z9Lo:Vd;_[n2Hd3Q[5XT9^Of=f=f=f=f=f=f=f=fѱ #&$x)/m*:c,BZ-IT1ON4TJ8WG=YEA[CE\AJ]?O]>T]=Z]<`\:g\9o[9s[9s[9s[9s[9s[9s[9s[9s[ǻ  wl )b#2X$:R(?L+DH/HE3JB7L@;M>?N,<<0>:4?87@7;@5>A3BA2FA1JA0NA.SA.UA.UA.UA.UA.UA.UA.UA.UAib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[nib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[njb\+"_6.f>9gECdMO_VZX`dQjkLupHsFtEtEtFtFtGsHsIsMrQrTqWqZp\p\p\p\p\p\p\p\pkd]+"c5-j<7lDBiKMdTX]^cUhkOrqJ~uHvGwGwHvIvKvLuMuPtTtWsZs]r^t^t^t^t^t^t^t^tl e^+!g3,n;6qC@oKKiRVc[a[ekSprN{vKxJyKyLyMxNxOwQwSvWvZu]u_u`w`w`w`w`w`w`w`wl f`*!k2*s:4vC>uJIpQTiY_aciYmrSxwOzN{O{P{QzRzSyUyVxZx^w`waybzbzbzbzbzbzbzbzm gb*!o1)x:2{B;{IFwPQpW\hag`jqXuxT|S}S~T}U}V|X|Y{Zz^zazb{d}e~e~e~e~e~e~e~e~n hf)t0'|:/B9IC}PNwVYo^dgho_rwZ|}WWXZ[\~^}_}a|d~efhhhhhhhho ij'x0%:-B6I?OJUUw\`oelgou`x}]\]^_`aÁaԁdgh߄iޅjޅjޅjޅjޅjޅjޅjޅjޅp km&|0#9*B3IDߵIԵE'ʱN:WK^[djiwnrv{xusrpqƦtǤvɢvɢvɢvɢvɢvɢvɢvɢx v#-6=Bۺ@йC%ƵM8UI\YbhgulptyxpkjihiǥkǤnȣnȣnȣnȣnȣnȣnȣnȣx y " -5; > 5˾A"K5SGYW_fdsim}qrui|eddcdʡeɡgɡgɡgɡgɡgɡgɡgɡgɡz } " + 3 742? H3PDWT\cape|ivmkrdza``__͛a͜c̝c̝c̝c̝c̝c̝c̝c̝{ !)/./ <F0MATQY`]nayydnhen_x]\\[[˔\ҕ^ї^ї^ї^ї^ї^ї^ї^ї} %%+ 9B,J>PNU]Yj|\vq_fc^jZvYXXWWʌWٌY֏Y֏Y֏Y֏Y֏Y֏Y֏Y֏ )6?(F:LJPY}SfsVrhY|^^XgVsUƁTȑTɡSʲRȃSTޅTޅTޅTޅTޅTޅTޅTޅٴ2=C%F5HEKTtMbiPm_SvWZ|Sd~Rq~Q}Pَ|PڞzPۯyOxNwOzOzOzOzOzOzOzOzڬк#3 :?*A9CGvDTjF__IiVMpQTtN^uMjuLwtLsKrKqKpJoKnKnKnKnKnKnKnKn ѳ&06 :.<\LCaHIcDPeBWe@`e>kdVCCX@IZ=OZ;VZ:^Z8hY6rY4|X3W1W1W1W1W1W1W1W1W˰ ~u# j&*`(3X+:P-@J0EE4HA8K>=L-<;1>96?7:@4?A2DA1IA/OA.UA,[A+b@)k@)k@)k@)k@)k@)k@)k@)k@yo e [ SK E%?):!,7%.4)02-1112/52-93+>3)C3(H3&M3%R3#Y3#Y3#Y3#Y3#Y3#Y3#Y3#Y3[S H+ M3(T;2TD=RMGMWQGbXBm]?y`=aa?`?`@`A_C_G^K^M]P]Q\Q\Q\Q\Q\Q\Q\\SI+ P2(V;2VCb=b=b>b?b@b@aAaBaC`E`I_L_O^Q^S^S^S^S^S^S^S^]UJ+ T1'Z91[B;YKETTOM^XGi_CubAd@e@eAdBdCdDcDcEcFbHbLaOaR`T`UaUaUaUaUaUaUa^UL*W/%_8/aA9^IDYSNS\XLg_GsdE~fDgCgDfEfFfGeHeIeJdKcOcRbUbVcWdWdWdWdWdWdWd_VP(\.$d7-f@7dHB_QLX[WQd_KoeH{hGiGiHiIhJhJhKgMgNfOeReUdWeYgZgZgZgZgZgZgZg`XT&a,"i6+l?5kG?eOJ_XUXb^QlfMwjKkKkLkMkNjOjPiQiRhShVgXgZi\j]k]k]k]k]k]k]kaYX%f, o5)s>2rFWI{`Ushbkpoexwc{b|c}c}d}e}e}f}g}i~j~kkkkkkkkg `o})2; B'I/O8ߊVB؃_P{f`smmmtwh|}ggghiijɁk݂lmnnnnnnnnh ar(2:B#H*N2ۑV<ӊ]M˂d]{kktqvox~lkkllmnÆnֆo݆p݆q݆q݆q݆q݆q݆q݆q݆q݆i du(1:AG$ߚM+זT:Ώ\KƈcZih{otuu~q|ooppqqrъrڊsڊsۊsۉsۉsۉsۉsۉsۉsۉi gx'19@FܟJ%ӚR8ʔZHaXgfms|r}wytsssttuˎu؎u؎u؍uٌuٌuٌuٌuٌuٌuٌj iz '08>D٣G#ϞQ6ƙYF`Vfdkqp|}vy|wvvwwwƒwԒwՑw֐w֏w֏w֏w֏w֏w֏w֏k l} & /6<ߨAէE"ˢO4XD_Tebjoozs~yzyyyzzzҖzӔzӓyԒyԒyԒyԒyԒyԒyԒk n % . 5 : ۬<ѪD ǦN2VB]Rc`hmmxqv|}}|{}y}x}v~ϙx}Зy|Җz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕl q  % , 2 6 ذ5ͮBêL/T@[Pb^gkkvos}xvsqonm̛nϙqИrїrїrїrїrїrїrїm t $*.ް/Ӵ3 ɲ@J-R>YM_\eiitmqwun|iggfeȚfϙhИjИjИjИjИjИjИjИn x "'(ڶ"ϸ1 Ķ>H+P;WK]Ybfgrk}{opsgycaa``ǖ`іbіcіcіcіcіcіcіcіo |!Իɽ.<F(N9THZV_dco~gztkjpbx_^]]\Ɛ\֐^Ց^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓq ׸+9C%K5QEWS[``lwcwmgcm]v[ZYYXĉX܈YۊZڋZڋZڋZڋZڋZڋZڋr ְϼ&5?!H2NASOW]y[io^sec|]iXsWVVUT€TUVVVVVVVw ٪е 0;D.J=NK{RXqVdfYn]^vWe{Tp|S~|R{RyQxPwPvPwQyQyQyQyQyQyQy  ۢѯȻ- 8?)E8|IFrLSgP_^ShVYoRbrPnrO{qNЊpNњoMҫmLӾlLkKlLnLnLnLnLnLnLnөɵ"0 8=(~@6sCChFN^IYVNaQUeN^gLjgLwfKdKcKbJ`J_H_FaFaFaFaFaFaFa֢˰#-4~8+t;7i=B_?LVBTOHZKN^HW_Fa_El_Dz^C\B[BZBYAX@W@W@W@W@W@W@Wۛͫø! )}.t2+i56_7?W:GO=MJBQFHTBOV@WV>aV=lU;yT9S9R8Q8Q7P7P7P7P7P7P7PЦŴ |#r(h+)_.2V19O4?I8DE=HABJ=HK:NL8VL6_K4iK3uJ1I/H/H.G.G.G.G.G.G.Gǯ y of]#$U'+N*1H.6B2:>6<;;>8@?5E@2L@0S@.[@-d?+n?)x>'>&=&=&=&=&=&=&=vm cZRL"E"'@&+;*.7.0421272/<3,A3*G4(M3&U3$\3"d2 m2t2t2t2t2t2t2t2tja XP HB<7!3 "0#$-'$++%)0%&4%#9&!?&E&K&Q%X%^%^%^%^%^%^%^%MD"<- A0"F8*GB5EL>AVE=aK:nN8zP7P7P7P8P9P9O:O;OM?LBLDKGKGKGKGKGKGKGKNE"?+E."I6*K@4JK=EUFA_L=kP;xQ:R:R:R;RP?P?P@OAOBNEMGMINININININININOF!B)H-!N5)P?3NI=ISEE]LAiQ>uS=T=T=T>T?S?S@SARBRBQCQDPEPHOJOKQLQLQLQLQLQLQQG!E(L+S4'U>1SG;OREI[MEfRBrUA~V@V@VAVBUCUCUDTETFSGSHRHQKQLRNTOTOTOTOTOTOTRH I&Q)Y3%[=/YF9UOCOYLIcSFoWDzXDYDYEXFXGWGWHVIVJUKULTMTNUPVRXRXRXRXRXRXRXSJ N$W(`2#c;-aD7\MAVWKP`SKkXIw[H\H[I[J[KZLZMYNXOXOWPWQWRYT[U\V\V\V\V\V\V\UKS!]'f1 j:)iC3dK=^THW]RQhYNr]M}^M^N^O]P]Q\R\R[SZTZUYT\V^X_YaZaZaZaZaZaZaVMXd&m0q9&pA/mI9fQD_[OXdXSo^RyaRaRaS`T`U_V_V_W_W_Y_XaZc[d]e]e]e]e]e]e]eWO]i%r/w8"x@*uG4oO?gXJaaU[k^WucVdWeWeXeXeYeZeZe[e\e\f^h_i`jajajajajajajXSbo$x.}7~>%|F/xM9rVDk_Pdh[^qd[zh[j[j\j\j]j^j^j_j`j`kbmcmdndndndndndndnZWgs#}-5=!D)L3{U=u]JleYfmdauk`~n`o`o`oaobobocpcpdpeqfrgrgrgrgrgrgrgr[[kw#+4<C#J,ڄT7|[GucVnjchqlezqdsdtdtetetftftguhuiuivjvjvjvjvjvjvjv\^o{" *3:AݎI$ԉR4̃ZD|aSug`onkkuri}vhxhyiyiyjyjykykylzlzmymymymymymymy\br ~" ) 18?ٔG ЎP1ljXA_P|f^vljqrsnyyl{l}l}m}m}m}n}n~n~o}o}o}o}o}o}o}o}]eu ! ( / 6ޚ=՘E̓O/ÎW?^Nd\}jhworsvyq}~poppppÂq؂q၌q။qဋq​q​q​q​q​q^g x &- 3 ۞8 ћDȗN-V=\KbYhf}mpysyuysrrssss҆sޅs߄s߃ssssss_j {%+/آ5 ͟BěL+U;[IaWfdko~pxzuw}uuvv~v}v͊|vۉ}v܇}u݆~u݆~u݆~u݆~u݆~u݆~u݆`m }"'ޣ*ԥ3 ɣ@K(S8ZG`Ueajmnws{y}yzyxyvyuyszȍszٌtyڊvxۉvx܈vx܈vx܈vx܈vx܈vx܈a p "ۧ!Ш1 Ŧ?I&R6YE_Rd_hklup{ut~}p}n}m~k~j~ďi׎l}ٍn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋb s֫ˬ/=G$P4WB]Pb]fijs}n}trlygedcba؎c؍eٌfٌfٌfٌfٌfٌfٌc wި Ѯư,;E!N1U@[M`Zdfhqxl{npeva_^^]\֊]ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊg { ԫ˲)8CK.R=XJ]Wac{enrjxhn`u\[[ZZYՃYބZޅZކZކZކZކZކZކl  զͯķ &5 @H+O9UGYT}^`tbjkftbk|[sY~XWW~V}U|U}VWWWWWWq   ؠϫƴ!1 <E'K6QCUPvY\m]fcbo\hvWqyU}zTyTwSvRuRsQtRvRwRwRwRwRwRwxܙѥȰ+8A"G1L?xQKnTWeXa\]iVdoRnpQzpPoPnOlNkNjMjMmMmMmMmMmMmMm՟˫%2;B,yG:oKFeOQ]SZUXaQ`eNkfMxeLȆdLȕcKɥaKʷ`J_J^GaHbHbHbHbHbHb٘ͦñ !. 7z=&pB3fE?]IJUMROTWL]YJhZIuYIكWIڒVHۢUGܳTGRFQDTCUCUCUCUCUCUߑѡƭ",z2p7'f:2\=HACDGFAOG>WH=aG;lG:yF9E8C8B7B7A7@7@7@7@7@7@˥~v m d%\*#T.*M21G66B;9>A<;G=8N>6V>4_=3j=1w22D20K3.R3,[2*e2(p1&|0%0#/#/#/#/#/#/#/zqh_ WOHB=!8%"4)#1.$.3%,8&)>&'E&%L&#T&!]%f%o$z$}#}#}#}#}#}#{oe\T LE > 840,)"''$+!05;BIQX`cccccc@7%5,9/ ;5$=@+;K49V:6b=5o?3{@3@3@3@4@5@5?6?6?7>7>8>9=:<:<;;<;<<<<<<<<<<<3#A>+?I4<>==>===????????????B9$;(@*C2"E=+DH4@R;=]@;jB9vD9D8D9D:C:C;C;B@?@@?@?@?@@BABABABABABAC:#?%D(H1!J;)IF3FP;B[A?gD=sF<~FE?E?D@DACACBBCBDADACBDDFEFEFEFEFEFED;#C#I'O/Q9'OD1LN:GXACcFAoH@zI@IAHBHBHCGDGDFEFFEGEGDHCHEGGHHJIJIJIJIJIJIE>!G!Q%V.Y8%WA.SK8NUAI_GFkJEvLELEKFKGJHJHIIIJHKHLGLFLGLJKKMMNNNNNNNNNNNNGCMW$]-a6!_?+[H5UR>P\GLfLJrNJ}OJNKNLMMMMLNKOKPJPJQJQLPOPQRRSSSSSSSSSSSSHGS^#e+h4h=&dF0^O:WXDRbLOmPOxRORPQQPQPQPRPRPSPSPTQURTTUVVWWXWXWXWXWXWXJKYd"k*o2p;!mC*gL5aV@[_JViQTtTT~VTVTVUVUVVVVVWWWWXWYXXZY[Z\[\[\[\[\[\[\KP_j!q(v1w9uA$pI/kT:d]E^eQZoXXx[X\X\Y\Y\Z\Z][][]\]]]]_]`^a_a_a_a_a_a_aMUdo w' |/~7}?yH'uR3mZBfbOajY^s^]|a]b]b]b^b^b_b_b`c`c`daebececececececeNYh t {& , 5=ۂG |P0uX?n`MhgXdo`bweafagagbgbgchchchdhdieifififififififiO\l x $* 2 ߊ:ևD΂N,|VN9.8E06L04U02^01j//w..--,-+,++*+*+*+*+*+*vme ^ VOH!B&<* 8/"55$2;%/A%-H%+Q%)Z%(e$&q#$~#""!!!!!!!!!!!!!!wkbZS LE>94 0%-*+/(4%:"A IR\fq|wk`WOH A :5 0,(&#" '+17?GP X aiiiiii3*)-*0-04 1?$0K(0W,/c/.o0-{1,1-1-1.1.0/0/00/1/1/2.2.3-4,4,4,3-3.3.3.3.3.4*(0(3+43 5=$4I)3U.2a11m20y3/3030212222231314040505/6.7.7-6.6060606060605,'3&7(:1;<$9G)8R/6^35j44v5353544545463637372829191:0;0;0:193939393939360$8#<%@.A9#@D*=O0;[49g68s78~7878796:6:6;5;5<4<4=3>3>2?2>4=5=7=7=7=7=7=785!= C$G-H6!FA)CL0@W6>c9=o:=z:=:=9>9?8?8@8@7A7B6B5C5D4C6B8B:A;B;B;B;B;B;9:BJ#O+P4N>&KI/GS6D^;Bj=Av=B=BI>J=J=KL@KBKDLELELELELELE<COY _(`0_9\B'VL2QV:Ma@LlCLwCMBMBMBNBNBNBOBOCOCPCQCPFPHPIQJQJQJQJQJQJ=HV`f&h.h6e?"_I,ZT7U]?RhEQrGQ{HQHQHRIRISISISITITIUJULTMTNUOVOVOVOVOVO?N\ f l% o+p3n<jG%dQ0^Z=YcFVlLUvNU~NVOVOVOWOWOWOXOXPYPYQYSYSZTZTZTZTZTZTCRa k r# v) w1v9sEmO,gW:a_F\hNZpRZyTZTZUZU[U[U[U\U\V\V]W]X]X^Y^Y^Y^Y^Y^YGV f pw!{'}- }7zCuM)oU7i]DcdN`lU_tX^|Z^Z^Z_Z_[_[`[`[`\a\a]a]a]a]a]a]a]a]JZ jt{$*ك4 πA{K&uS4pZAkaMfhUdp[cx^b_b_c`c`c`c`cacadadadadadadadadadaM^ mw އ%ԇ2ʅ?I#|Q1vX>q_JmeTil\gs`f{cfdfdfefefefeffffffgegegegegegegeP b pzڋЋ0Ɖ>H P.|W]IaTe_|}jhuyopowvvkvxiuygvyevydvxcvxbvwdvueutftsftsftsftsfts_q~݈Ԑ͖Ě&5 AI"Q/V;[G`Rd\whfolog}svc{{y`{z_{z^|y]|x\}w[}v\{u^yu^yt^yt^yt^yt^ytbuًГȚ "2>GO,U8ZD^OzbYrfcijlapt\ywZxYwYvXtWsVrVsXsXsXsXsXsXsgy߅ԏ˗Þ/;EL)R5XA|\Ku`Vld`dii\ooXxrVrVqUpUnTmSlRmSnSnSnSnSnSnl}ډϓƜ+8 BI%O1~U=wYHn^Rfb[^gdXniUxkSkSjRhRgQeQdOfOgOhOhOhOhOhrԎʘ&4 >F!L-xQ9pUChZM`^VYd]TlbQvcPbOaO_N^N\M[L]J_K_K_K_K_K_yۇϔŞ /:AyH(qL4hQ>`UGYZOS`UOiXMtYLXLVKUKSJRJQIRFTFUFUFUFUFUԎɚ(4 y<qB#iG.`L8YPARVGN]LKfNIqNH~LHKGJGHFGFFEFCIBJBJBJBJBJۇ͕¡ ~x,p5h<`A'XF1RK8LQ>HYAFbBEnADz@Dʈ?Cʘ>B˨=>=>=>=>=Ґƞzrn#g- _5X:Q?(JE.FL3CT5B^5Ai4@v3?܄2?ܓ0>ݣ/>޵.=-<,:/9090909090ɚ{qkd]& U,N1G6"B='>D*;L,:U,9_,8k+7x*6)6(5&4%4%3$3$3$3$3$3$|qhb[TM$F)@/;5 8;"5B#3J#1S#0]"/h"-v!, +*)))))))~rg^X QJ D>!8&4+11.7+=)E'N%W$c"p ~sg\TMG@ :50- *%&*#0 6=FOZfr~      tg\RJC<6 1 , ($!"'-4 < EOXblooooo&!!)%)',%3&>&K%W%d!%p"${"$"%"%"&"&!&!'!(!( ) )*++++** * * * * '!#'(&*)+1+<*I!)U!)a#)n$(y$($($)$)#*#*#+"+","-!-!. / //. .!-"-"-"-"-"( '%,#.&1/1:0F"/R#.^%-k&-v&,&-&.&.%/%/%0$0$1#1#2#3"3!4!3!2#2%2&2&2&2&2&)+!1 4#8-886C"4O%3['3g(2r)2})2(3(3(4'4'5&5&6%7%7%8$8#9#8%7'7)7*7*7*7*7**/6@";K&9W*8c+8n,8y,8+9+9*:*:););(<(<'='>&>&>'=*=,<.^.=j/=u/>~.>.?-@,@,A+A+B*B*C)D)D*C-B0B1A3A4A4A4A4A4/;CLQ&Q/O8JC$GN+DY0Ce2Cp2Cz1D1E0E/F.F/F/F/G/G/G/I0H3G5G7F8F9F9F9F9F94@KUY%Z-X5S? NI)KU0I`4Hk5Iv5I5I5J5J5J5K6K6K6L6L6M7M9L;LK>K>K>K>9ER \ a# b*a2];XG#TQ-P[5Nf9Np;Ny;NQ@PBPBPCPCPCPCPC>J X bg! j' i/f8cD]N)XW5T`GN)T5Y@]J|bTxyf]rvlelssjhr{mfrndrncrnarm`rm_rl_rkaribqhbqhbqhbqhbqh_o{Մ͋Đ 0<EM&R2W=\G{`Qsd[l|iceyoj`xxn^wo\xo[xnZxmYxlXykXxkYwjZviZviZviZviZvics~чȎ.: CK#Q/V:}ZDv^NncXfga_mhZulXmWlVkUiUhTgSgS~hT|gT|gT|gT|gT|ggv؂͋ē*7 AI O,T7xYAq]KiaTae]ZlcVtgTgSfSeRcQbQaPaNbOcOcOcOcOcl{ӆɐ%3>FL(zR3sW=k[Fc_P\dXVk]Rt`Q`P^P]O[OZNYMZK[K\K\K\K\K\qۀ΋ĕ /:B{I#tN.lS8dWB]\JWbQRiVOsWNWMUMTLRLQKOJPIRGSGSGSGSGSwԆɑ)5 {>tEmJ)eO3^S@>@>@>@>ԇǔ{vq'k1 d9]?VD%OI-JO2FV6D_7Bj6Bv5AÄ4@Ò3@Ģ1?Ĵ0>/>.=0;2;2;2;2;2̐tj f`'Z0 T7M=HC#CJ'@R)>[*=f)3J2V2b2m2x2334455677888766!6"6"6"6"6"'06?B%A/>:;E9Q!8]!8i!8s!9} : :;;<<====>> =#=%<&<'<(<(<(<(,6?GK#J,G5C@@L">X$>d%?o$?y#@#A"A"A"A"A"B#B#B#C#C$C&C(B*B,B-B-B-B-B-2<G O S! S)P2L<GG!ES%E_'Ej(Es)E|)F)F)F)F)G)G)G*G*H*H+I,H.H0G1G2G2G2G2G27A O W[\& Y.U7RDNO%KY+Jc.Jm/Jv0J~0K0K0K0L0L0L1L1L1M2M2M4M6L7L7L8L8L8L8<G U]bc"a*_5 [AWK#SU-P^2Og5Op6Oy6O6O6P7P7P7P7Q7Q8Q8R8Q:Q;Q_H ZQ,WZ4Ub9Tk;SsU>U?V@UAUAUAUAUAUAUAC S_ glmnn/k<gFbO)^V4[^;Yf?XnAXvBX}BXBXBYCYCYCYDYDYDYEXFXFXFXFXFXFXFG Wc k o p rs,r:nDiL&eT2a[:^bA]jD\qF\yG[G[H[H[H\I[I[J[J[J[J[J[J[J[J[J[JK[gnrtwx*w8 sBoK#kR/gX9d_AafF`mI_tK^|L^M^M^M^N^N^O^O^O^O^O^N^N^N^N^NN_jpuxz}({6 y@uI qP,mV7i\@fbGciLbpOawPaQaRaRaSaSaT~aT}aT|aS|aS{aR{aR{aR{aR{aRQalsy|~%4}?zGvN)sU4oZ>k_FheLelQdsTd{V~cW|dW{dXydXwdXvcYtcYtdXtdVtdUtdUtdUtdUtdUTdnv|#2=~F{M'xS2tXv~]Go{aPhxfXbvl_^ttc[t~dYtdXtcWtbWtaVu`Ut`Ut_Vr^Wr^Wr^Wr^Wr^bp{˄(5?GM&R1yW;r[Dj_McdU]}j\X{raU{|bT{aT|`S|^R|]Q|\Q|\P{\Py\Py\Py\Py\Py\ftLj$2=EK#{P-tU7mY@e]I^bQXhXTq[R{\Q[PZPXOWNUMULWKWKXKXKXKXkÿ́Œ .9 B|IvN)nS3gW<`\DYaLTgQPpTN{TNSMRMPLOLMKMIOHPHQHQHQHQp~ȉ)5 }>vEoK%hP.aU7ZZ?T_FPfJMoLL{KKJJIJGIFIDHDFFEHEHEHEHEHw΄Ï#|0v: oAhG aL)ZQ1TV9O\>KdAImBHyAG@G?F=EA>A>A>A>~ȋ}xt*n4 g<aBZG"TL*NR1IX5F`7Ej8Dv7C6B4B3A1@0@/?1=3=3=3=3=3Ά“tmj!d-_5 X<RBLG"GM'DT*A],@g,?r+>*=(='<%;$;#:$8'8'8'8'8'Ǐ{nb]Y"U,O3 J:D@@G=O;X :b9m8z7̉7͘6ͪ5Ϳ4422222~rf\RLID(@0 ;78?5G4P3Z2e2r1ހ0ߐ/.-, *****ti]SJE @;6% 2, /3,;*C)L'W&b%p $ # " ! vj_TJA<7 3/ +! '' $. !5 = F P \ j z xl_TJA83/* &"  & - 5 > HTbq{naUJ@7/*%!  #+4>JVco{}}}}(%%(0<IVb n y                   &#"%.:GT`lv                      #",7DP]is}      ! " ! " ! ! !!!!!! !%()'4%@$M#Y#e#p#y$$%%&&''( ( ) ) ) )((((((($'.1&01.<,H+U+a+l+v,~,---../00011000/////#*18:#9,784C2P2\2g3r3{44556666777877766666)1; B D C)@3<>9J8W9b:m;w;;<<<<====>>>== =!="="="="/7 C JM L% I.D9AE@R@]@gAqAyABBBBCCCCC D D#C%C&C'C'C'C'C'4 > J RUT!Q) N4KAHLGW"Fa#Fk$Gs$G{%G%G%G%H%H%H%H&H&I&I'I)I+H,H,I-I-I-I-9 EQ X[[X#W1 T>QHNR$L\(Le*Kn+Lu+L}+L+L+L,M,M,M,M-M-M.N/N0N1M2M2M2M2M2= KW] ``__.];YEUN$RW+Q_/Ph0Pp1Pw1P2Q2Q2Q2Q2Q3R3R4R4R5Q6Q7Q7Q7Q7Q7Q7AQ[accef+d8 aC\K#YS+W[1Uc5Uk6Us7Uz7U8U8U8U8U9U9U:U:U;U;T;T;T;T;T;T;EU_dhhjl(k6 g@cI `Q*]X2[_7Yf:XnX>X?X?W?W@W@W@W@W?W?W?W?HXahlmoq&p3m>iGfN(cU1_\8]b<\i?[pAZxAZBZBZCZCZDZDZEZEZEZD~ZD~ZC~ZC~ZC~ZCL[dlprsu#u1r<oElL%hS/dY7b_=_eA^lD]sF]{G]G]H]H}]I|]Iz]Jy]Jx]Iw]Iw]Hw]Gw]Gw]Gw]GP^gotvv y!y/w;tCqK"mQ,iW5f\=cbBahF~`oI|`wKz`Ly`Lw`Mu`Mt`Nr`Np_Op`Np`Lp`Kp`Kp`Kp`Kp`KSakrwyz |}-{9 yBuI rO*oU3kZ;h_B{feHwdkLtcsOrc|PpcQocRmcRkcRicRhbSgcRhcPhcOhcNhcNhcNhcNVcnuz}}+7 }@zHwN'tS1qX:{m]AukbHqhhNmgoRjfxThfUffVdfVcfVafV`fV_fU`fS`fRafQafQafQafQYfqy~(5>F|L$yQ.}vV7vs[@pp_HjneOelkTbktW_j~Y^jY\kX[kXZkXYkWXjVYjUYjTYjSYjSYjSYjS]jt|%2<DK"P+x|U5rzY=kw]FetbM_rhT[ppXXpzYWpYVpXUpWTpVSpVRpURpTRoTSoSSoSSoSSoS`nxĀ"0: BIzN(tS1mW:f~\C`{`KZyfQUxnUSwxWRwVQxUPxTOxROxQNxPMwQMvQMuQMuQMuQMuQdr| ,7 @|GvL$oQ.hV7bZ?[_FUeLQmPOwQNPMOMMLLLKKJJKI~LH}LH}LH}LH}Liwǁ(4}=wDpJ!jO*cT2\X:V]AQdFNlILwIKHKGJEIDICHBGCFEEEEEEEEEo|‡#}0w: qAjHdM%]R-WV5R\;Mc?JkAIvAH@H>G=F;F:E9D:B4>4>4>4}Évpl#g/b7 \>VDPJ KO&GV*D]-Bg-Ar,@~+?*?(>'=&<$<%:'9)9)9)9)ȅ}ofa]'Y0S8 N>IDDJ@Q >Z"KW c n w    ')#(/%:#G"S"_ "j "s #| $ $%%&&'''(((( ) ) ((((($ * 1 3! 1*.5,B*N*Z+e ,o ,x - . . . . / / 0 0 0 0 1 11000000$+ 5 ;< ;& 704<2H2U3`4k5t5{6667777888888877777* 3 > DFD!@* ;5 :C;P;[>>>>>>??>>>>>>>0 ;F LMKG$F1 D>BJBUB_BhBpCxC~CCCDDDDDDED D!D"D#D#D#D#5BLQ R POP.N:KEIOHYHb Hj!Hr!Hy!H!H!H!I"I"I"I#I#I$J$I&I'I'H(H(H(H(:HQUUTWX*V7 SBPKNT#M]%Me&Mm'Mt'M{'M'M(M(M(M)M)M)M*M+M,M,M-L-L-L-L->LUY\\]_']4 Z?WHTP$RX(R`+Qh,Qo-Qv-Q}-Q.Q.Q.Q/Q/Q0Q0P1P1P2P2P2P2P2P2CQX_bbce$d2a=^EZM#XU*V\.Uc0Tj2Tq2Tx3T3T3T4T4T5T5S6S6S7S7S6S6S6S6S6GT\dgggj!i/g:dCaK!]R)[X/Y_3Xf6Wm7Vt8V{8V9V9V9V:V:~V;|V<{V{Y>yY?xY?vY@tY@sY@sY?sY>rY>rY>rY>rY>NYdkopprr+q6 n?kGhM%dS-aX4_^9}]d=z\k?x\sAv\{Bu\Cs\Cq\Do\Dn\Dl\Ek[Ek\Ck\Bk\Ak\Ak\Ak\AQ]hostsuv(u4s>pEmK#iQ+fV3{d[9wba>s`gBp_oEn_wFl_Gk_Hi_Hg_He_Hd_Ic^Hc_Gc_Ed_Dd_Dd_Dd_DT`krvwwyz&y2w<tCrJ oO)|lT1viY9qg^?ledDickHfcsJdb}KbbLabL_bL^bL\bL[bK\bJ\bH]bG]bG]bG]bGVdnuy{z|~#}0{: yBwH}tM&xrR/roW7ll\>fjaEbhhJ^gpM\gyNZgNYgNXgNWgMUgMTfLUfKUfJVfIVfIVfIVfIYhry}~ -8 ~@|FyzL#sxQ,muU4gsZ{EuJ o~O)i|T1bzX9\w]@WucGStkJPstLOsKNtJMtIMtHLtGKtFKsFJrFJqGJqGJqGJqGcpz&2|; vBpHjM%dR.^V5X[Is?H~>H=G;F:F9E7D8C:B;B;B;B;oz zv*q5k= eC_IYN$TS+NX1J_5Gh6Fr6E}5D4D3C1C0B/A/?1>3>3>3>3uÁxrn$i0d8 ^?XESKNP$IV)F^,Dg-Bq-A},A*@)?'?&>%=%<':):):):)||oh d`)[2V: Q@LFGLCS @Z#>c#=n#)G'Q&[%h$u#τ"ϕ ϨϾzmaUJ?5,$!$.8BMYgv }pcWLA6-%'0 ; FSbsseYMB7.%  (2>L[m~ugZNB7-$  )5CSdt"  " - 9 FS_jt}  + 7 D Q\hr{    ( 4 @ MYdox         % 0 = I V a k t|   " , 8 E Q]gqy!!!      $ ) * (( %3 #? "L"X"c#m$u$}%%&&''((())*** ) ) ) ) )  $/ 341".- +9 *F+S-^.h.p/x/~000111122 2 2 2 211111% /8< <:5&334A 5M 6X 6b 7k 7r 8y 8 8 8 8 9 9 999999999999+7?CB ?=>.=< =H=R=\>e>m>t>z>>???????@@??????0>EGFCFH*G7 EBDMCVC_CgDoDuD|DDDDEEEEEDDDDCCC7CINPMNQ'O4 M>KHIQIZIbIiIpIwI}IIIII I I!I!I"H#H#H$H$H$H$<GNUWUUX#W0T;QDOMNU M]"Md#Lk#Lr$Ly$L$L$L%L%L&L&L'L'L(L(L(L(K(K(K(@KT[^\[ ] ].[9 XBUISQ"QX%Q_'Pf(Pm)Ot)O{*O*O*P+P+O,O-O-~O.}O.}O-|O-|O-|O-|O-DNY`cb` bb+a6 ^?[GXN"VT'T[*Sb,Si-Rp.Rw/R/R0~R0}R1{R1yR2xR2vR3vR2uR2uR1uR1uR1uR1GS^dggefg(f4c=`E]K ZR'XX,W^/Vd1}Uk3{Us3zU{4xU5wU5uU6sU6qU7pU7nU8nU7nU6mU5mU5mU5mU5JWbhkkijk&j2h;eCbI_O&]U,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;hXf[>e[?c[?a[?`[@^Z@_[>_[=_Z<_Z;_Z;_Z;P_horrprs s-q7 o?lE|jK!wgP)qeU0lbZ6ha`;e_g>b_oA`_xB^_B]_B[_BZ_BY^BW^BW^AX^?X^>Y^>Y^>Y^>Tblrvvtv ww+u5s=}qDxoIrmO'mjS.ghX5bf^;^dd@[clCYcuDWcEVcDTcDScDRcCQcCQbBQbARb@Rb?Rb?Rb?Yfovyyxz{{(z3y; ywBtuHnsM$hqR,cnV3]l[:Xja?UiiCRhrDQh}EPhDOiCNiBMiALi@Lh@Lg@Lg?Lf?Lf?Lf?]jsy}}|~$0{~9 u}@o{FjyK!dwP)^uT0YsY7Tq_=Ppg@MpqBLo|AKp@Jp?Jp>Ip=HpkDeJ_~N%Y}S,T{X3Oy^8Lxf;Jxo}1>}1>}1nyxrn$j/e8_?ZEUJOO"KU'G[+Dd,Cn,By,A*@)@'?&>%>$<';(:):):)typi eb*]3X; SANGJMFS BZ"@b#>l#>x"=!< ;;::876 6 6 |vi`[X#U-P5L< GCCI?O3) ,=Nar    +8ER]gqy    (5BOZenw~    %2?KWakt{     ".;GS^hqx      )6C OZdmu|   !!%0=JU_iqx~  !""""!!! (+ *'#) 6!D#P%[&d'l't(z())))****++++++ + + + )031 -)!+0->.J0U0_1g1n1u2{22223333333 3 3 3 333%1785/ 46+797E 7O 8Y 8a 9i 9p 9v 9| 9 9 9 : : : : : ::::9999,7<@A<>A&@4?? >J>S?\?d?k?q?w?~??@@@@@@????>>>2<CIJGFI"I0G; EEDNDVD^DeDlDsDyDDDDDDDDDDCCCCC7@KQSPN PP,N7 LAJIIRHYH`HgHnHtH{HHHHHHHHG G G ~G ~G ~G <GQWYWTVV)U4 R>PFNMMUL[Kb Ki Kp!Kw!K~!K"K"K#~K#}K${K$zK%yK%xK%wJ%wJ$wJ$wJ$?LW]_]Z[\&[2X;UCSJQQPW"O^$Nd%Nk%~Nr&}Nz&{N'zN'xN(vN)uN)sN*rN*qN*pN)pN)pM(pM(pM(BQ[aca^_a$_/]9 [@XGVN TT$}RZ'{R`(yQg*wQn+uQv+sQ,rQ-pQ-nQ.mQ.kQ/jQ/iQ/hQ.hQ-hQ,hQ,hQ,GV_egebce!d-b7 `>]E~ZKzXQ$wVV(tU\+qTc-oTj/mTr0lT{1jT1hT2gT2eT3cT3bT4aT3aT2aT0aS0aS0aS0KYchkifg hh*f4d<ICC_PROFILE bCz_Iv]N#q[T)mYY-jX_0hXg3fWo4dWx5bW6`W6_W7]W7\W7ZW7ZW6ZW5ZW4[V3[V3[V3O]flnljk ll(k2i: {gAvdGqbL"l`Q(h^W.d]\2a\c6^[k8\[t9Z[~9Y[:W[:V[:UZ:TZ9SZ9TZ7TZ6TZ5TZ5TZ5Tajoqpmopp%o0}n8 wl?rjEmhK hfP&cdU-^bZ3Za`7W_h:U_q;S_{}$>|#<{%;y&;x';x';x'mwwpj fb)^2Y: T@PFKKGQCX!A`#?i#>t"=!< <;::87777t~sib]Z#V.R6N= ICEIAO>V<^:h9s98765543222{|pdYS PM'J0F8B> >E;L8S6\5e4p3}211 0 . . - ,,,wk_TIDA?(<1885?3F 0N /W .a -l ,y+*('&%$###}rfZNC820/&-/*6(>&G%P$Z"e!r xmaUI<1(  )2;DOZgv sfYMA5*! (3>JWfv͈͚̮wi\PD8-#  !+7DScu߇߬߻zl_RF9.#  #/>N_r~pbTH;/$  '7HZl|  )6COZenv}  &3@LWbksz  #/=HT_hpw}   +8DP[dmtz    '3@LV`ipw}  !- 9 F Q [dlsy!%2@LW`hou { !!!"""####$$$$"''#"-%;'G(R)[)c*j*q*w+|+++,,,,,,---,,,,*-10**.'051B1L2U2^3e3l3r3x3~3344444444 4 3 3 3 3 '08<<869#909<9G 9P 9X 9` 9g 9m :s :y : : : : : : : : : ::9999-6@FFB? BB,A7@A ?K ?S?Z?a?h?n?t?{??????????>>>>1>HNOJGII(H3F= EFDNCUC\CcCiCpCvC}CCCCCC}C|CzCzByByByB5EOTUQMOP%O0M9 JBIJHQGXG^GeFkFrFy~G}G{GzGxGvFuFtFsFrFrFrFrF<KTYZVSTU!T-R7 P?NFLMKSJZ}J`{JgyJnxJuvJ}uJ sJ rJ!pJ!nJ"mJ"kI#kI"jI!jI!jI jI APY^^[WXYY+W4 U<SC~QJ{OPxNVvM\!tMc"rMj#pMq#oMz$mM$kM%jM&hM&fM'eM'dL'cL&cL%cL$cL$cL$FT]ba_[\ ]](\2Z: }XAyUGuSMrRR!oQX#lP_%jPf'hPn(gPv)eP)dP*bP*`P+_P+]P+\O+\O*\O)\O(\O'\O'KX`edb_`aa%`/~_8 y\?uZEpXJlVO!hUU%eT[(cSb*aSj,_Ss-^S}.\S.ZS.YS/WS/VS/UR/UR-VR,VR+VR*VR*O\dhgfbdee"e-zc6 ua=p_Ck]Hg[M!cZS&_XX*\X_-ZWg/XWp1VWz1UW1SW1RW1QW1PV1OV1OV/OV.PU-PU-PU-S`gkjifghj{i*vh3qf; leAgcFbaL^_Q%Z^V*V\\.S\d1Q[m3P[w3N[3M[2L[2K[1J[1I[0IZ0IZ/JY.JY.JY.Xckmmljkm {nwn'rm1ml9 hk?ciE^gJYfO#UdT)QbZ-Nab1Kak2Jau2Ia2Ha1Ga0Fa/Ea.Ea-D`-D_-D^-D^-D^-\hopppnp{qvrrs$ms.hr7dq=_oCZnHUlM PkR&LiY*Ii`-Ghi/Ehs.Dh.Dh,Ch+Bh*Ah)Ah(@g)?f*?e*?d*?d*alsttss|uvvpxly hy+cx4_w; ZvAUuFPsKLrQ!HqW&Ep_(Cph)Apr)Ap~'@p&?p%?p$>p#=p"yq!=y} @D 3* '%#("0 8AJT_ky |qeZOD8-# !* 3 = GR_m}wl`UI=1& %.9DP^oĀĒĥø~sfYL?3(  '2>L\oւַ֧֕wi\OB5*  +8GXl{m_QD7+   #2BTfy'3@MXbkry~ $0=IU_hov|   ,9FQ[dlsy~  (5AMW`hou{#/<HS\dkrw|   (6BNW`gnty~   / <HR[cjpv{)7C N!W!^"e"l"r#w#}###$$$%%%%%%%%%")-+%!&$(2)>*H+R+Y,a,g,m,s,y-~--------------!+5983- 12,283C3L3T3\3b3h3n3t4z444444444 4 4 4 3 3 &5>BA=8:;(:3:>:G9O 9W 9] 9c 9j 9p 9v 9} 9 9 : : : : : : }9}9|9|9|9.=FJHD@AC$B/@9?B ?J >R >X>_>e>k>r>x>>~>}>{>z>x>w>u>u=t=t=t=5DLPNJFGI H+F5E> CFCMBTBZB`~Bg|Bm{BtyB|xBvBuBsBqBpBnBmAmAlAlAlA<IRUSOLL NN(L2J; IB~GI|FOzFVxE\vEbuEisEqqEypEnEmEkEiEhEfEeEeEeDeDeDANVXWTPQRR%Q/P8 |N?yLEuJLsIRpIXoH^mHekHmjHuhI~fIeIcIaI`H ^H ^H^H^H^H^HFRZ[ZXTUVW"V-|T5 xR<sPCpOIlMNiLTgL[eLacLi bLr!`L{"_L"]L#\L#ZL$YK$WK$WK#WK"WK!XK XK JW^^][XYZ[}Z*xY3sW: oU@jSFfRKcPQ`PW!^O^#\Of$ZOn%YOx&WO&VO'TO'SO'RO'QN'PN&QN$QN#QN#QN#OZaa`_[]^}_y_(t^1o\8 jZ>fXDaWI^UNZTT"WS[%USb'SSk(RSu)PS)OS)NS)MS)KS)JR)JR(KR&KQ%KQ%KQ%S^ddcb_a}b yctc%pb.ka6f`<b^B]\GY[MUYR"RXX&OX`)MWh*KWr+JW~*IW*HX)GX)FW(EW(EW'EV'EV&EU%EU%Wbfffeceyfsgoh"kg,gg4be; ]d@YcFUaKP_P!M^V%J^^(G]f)F]q)E]|)D](C]'B]&A]%A]%@\%@[%@[%@Z$@Z$\eiiiigzitknljmfm)bl1]l8 Yj?UiDPhILfOHeU"Ed\%Cde&Ado%@d{%@d$?d#>d!=d!=d ;9$6,441;/B-J+R*[)f'r&%$"! ~si]RI>4.,*$(,'4%<#D!M VamzyncYMC8.$  )1:CMW d q ti^SH=2( $-7AKXeuzodYNC7," )3>IWfxvj_TH;/$ %/:FVgzύϟϰϿ}rfXK>1&(5CTf{xj\NA3'.>Pdx $1>JU^gnuz    -;GR[dkrw|  )7CNX`hoty~%1>IT\dkqv{ ,9EOX`gmsx| %3?JS[cioty~ +9DNW ^ e k p v {    %3?IRY`flrw}&)& -":"D#M#U$\$b$h$n%s%y%%%%&&&&&&&&&&)252-% (+(+4,?,H,P,W,^-d-i-o-u-{--.........--%3;=:7114#4/3:3C3K3R3Y3_3e3k3q3w4444~4}4|4z4y4 w4 w3 v3 v3 .;CCB>:9;;+:59>9F8N8T 8Z 8` 8f 8m ~8s |8{ {9 y9 x9 v9 u9 s9 r9 p9 o8 o8 n8 n8 5BJIGDA? AA'@1?:>B =I ~=P |=V z<\ y yBE wAKuARs@Xq@^o@en@ll@tkA|iAgAfAdAcAa@`@`@`@_@_@@MQQPMJJKL K*{J3wH: sFApEHmDNkDTiDZhDafDhdDpcDyaD`D^D]D[DZDYCYCYCYCYCEQTTSQNNOP{P(vN0rM8 nK>jJDgIJdHPbGV`G]^Gd]Gm[GvZGXHWHUGTGSGRGRFRFSFSFJUWWVTQRS zTvT%rS.mR5iP< dNAaMG]LM[KSYKZWKaVKiTKsSK}QKPK NK MK LJ KJLJLILILINXZZYXTV{WvXrX"mX+iV3dU: `S?\REXQJUPPSOWPO^ OOf!MOp"LO{"KO"IO"HO!GO!FN!EN FNFMFMFMR\]]\[X|Zv[q\m]i\)d\1`Z8 \Y>XXCTVHPUNMTTJT[!HSd"GSn#FSy#ET"DT"CT!BT AS @S@R@R@Q@QW____^\x^q_lagadb&`a/\`6W_< S^AO\GL[LHZSEYZ CYb!BYl!AYw!@Y ?Z>Z=Z FjCBiI?iOz8:z>7zE 5zL 3yT 1y\ 0yg /yr .y -y ,x+x*x*w)u(t (s (s oppp~qusju_yV{N~E?<:$8,543;1B.I-Q+Z*d)p(|&%$#""~!}!|!|sttu{vqxf{ZQH?51/-%,-*5(=&D$M#V!` lxxxyzw{l~aVLC9/&" %-5=FOZer  }}~}rg\RG<3) " * 3<FQ\ixxmbWLA6,"  (1;EQ^m}~sg\QF;0&  $.8CP_pynbWLA5*  )4@O`rɆșȪǹui^SG9-! $0=N`t߳߳|qgYK=/# ,:L_s   !/;GR[ckqv{  +8CNX`hnty}&3?JT]dkpuz~ ".;FPY`gmrw{)6AKT\cinsw|#0<FOW^djoty~ (5@JRY`fkpuz  ! / : D MU[aglrw} #$  )5?HPW]chntz'/.+' "#$0$:%C%K%R%Y%^%d%j%p&v&}&&''''}'|'{'z'y'y'$17641,(+,*,5-?-G-N-T-Z-`-f-l-r-y}-|.{.y.x.v.u.s.r.q-q-q--9==;841 23&303:3B3I3P~2V}2\{2az2hx3nw3vu3~t3r3q4o4n3l3k3 j3 i3 i2 i2 4@BBA>;89:"9,95}8={8Ex7Kw7Qu7Ws7]r7d p7k o7r m8{ l8 j8 h8 g8 e8 d8 b8 b7 a7 a7 a7 :FFFEB@>>?~?(z>1v=9t<@ qS>T>T>ELMMMJHG}H xItI"pH+kG3gF: dD@ aDF^CL\BR[BXYB`XChVCqUC{SCRCPCOCNCMBMBMAMAMAIOPPPNK~KxLsMoMkM)gL0bJ7 _I= [HCXGHVFNTFURF\QFeOFnNFxLGKGJGHGGFFFGEGEGEGEMRSSSQNyOsPnQjRfR&bQ.^P5ZN; VM@SLFPKLNKRLJZJJbHJkGKvFKEKCKBKAK@J@JAIAIAHQUUUUT|QuSnUiU eVaV#]V,ZU3VT9 RS>NRDKQJHPPFOWDO_BOiAPt@P?P>P=PU^=UhGPZer qqqyrotdwZ{OF<3*! %-6> H R^kyvv~vuxj{_UK@6-# %-6?JVcq{{{|peZPE:0&  #+4?JWfvvk`UJ>4)  (2=JYiz|qfZOD8.# $.:IZl’¤xlaVK?3( *7HZnقڔ٣ٮٳti^SG9+'5GZn,8DNX`hnsx|(5@KU]dkpuy} #0<GQYaglqvz~+8CLU\cinrw{ &2>GPX^djnsx| ,8BKSZ`ejoty~ %1<EMU[afkpuz  *6@HPV\bglqw}    $0:CKRX]chntz~}}||%('%!*5>FMSY_djpw}|z y x v u!t t s $.00.+&! "$%%0%9%B&I&O&U&[~&`|&f{&my&tx'|v'u's'r'p(o(n(l(k'k'k',46652/**+!,+,5~,=|,Dz,Ky,Qw,Wv,\t,cs,iq-pp-xn-l-k.i.h.f.e.d-c-c-c-39;<:85112}2'z20w28u2@s2Gq1Mo1Sn1Yl1_k2ei2mg2uf2d3c3a3`3^3]2\2 \2 [2 [1 :>?@?<:77 {8w8#t8,p74n7<k6Bi6Ig6Of6Ud6[c6ba6j `6r ^7| ]7 [7 Z7 X7 W7 U6 U6 U6 U5 U5 ?BCCC@?<z<v=r= n=)j<1g;8d;?b:E `:K ^:Q ]:W [:^ Z:f X:o W;y U; T;R;Q;O;N:N:N9N9N8CEFGFDB{@uAqAmBiB&eA.a@5^?; [>A Y>G W>M U=TT=[R>cQ>lP>vN>M?K?J>I>H>G=H=H<H<FHIIIG|EvEpElF gFdG#`F+\E2YD8UC> RBC PBJNAQMAXKB`JBiIBsGBFBEBCBBBABAAAAB@B@IKLLLKyHrIlJgJ bK_K [K)WJ0TI6PH; MGA KGGHFNFFUEF]CFgBFqAG}@G>G=G ARD>RJ;RQ9QZ8Rc7Rn6Rz5R5R4R3R2Q1P1O1N1NRSTU~UuUjTbV\XWYRZ N[K[ I[(F[/BZ6?Z< /hE-hL+hU*h_)hj(hv'h&g%g$f#f"e"c!b!a\]^|_r`ia]cVeOhGj?m7o4o1p0p$.p,,p3*p:(pB&pJ%pR#p\"pg!pt poonmlkjiaabxcndeeZhRkJnBp9s1u*w 'x%x$x&"x.!x6x>xFyOyXycxpx~xwvutsrqee~ftgkhajWnMqEt2'  !/AUj}(5ALU]djpty} $1=HQYaglqvz~ -9CMU]cinrw{(4>HQX_ejnsw| #.9CLSZ`ejosx})3=FNU[`ejoty~ "-7AIPV\afjou{ &1;CKQW\aflqw~~  +5> F L R X ] c h n u | ~ } { z ywvvv!! %/9AHNTY_~d}k|qzyywutsqponmm#'))'%! *4<~C|J{PyUw[vaugsnrvp o m l!j!i!g!f!e!e!e *./0.,)%"#}$&z%/x%8v%?t%Fs%Lq%Ro%Wn&]l&dk&ki&sh'|f'e'c(b(`(_(^(]']']'/35532/,~* z*w+"s++q+3o+;m+Bk+Hi+Nh+Tf+Zd,`c,ha,p`-y^-]-[-Z-Y-W-V-V,V,V,4799864|2x0t0p1m1'j1/g17e0=c0Da0J`0P^0V]0][1dZ1mX1vW2U2T2S2Q2P1O1O1O0O08:<=<:|9w7s5o5k6g7$d6,a53^5:\5@Z5FX4LW4RU5YT5aR5j Q5t P6~ N6 M6 K6 J6 I5 H5 H4 H4 I4 ;>?@@=x<s;n:i; e;b; ^;([:0X96U9<S9BQ8H O8O N8V M9^ K9g J9q I:| G: F: D: C: B9 B9 B8 B8 B7 ?ABCC{Au?o>i?d?`@\@Y@&V?-R>3O=9M=? K=E I=L G=S F=[D=dC>nB>z@>?>>>=><=;=;<<<<;BDEFFxDqBjBdC_D[DWETE#QD*MD1JC6GB< EBC CBI ABQ?BY>BbN9;N? 8ME 6MM 4MU 3N^ 2Ni 1Nu 0N /N /N .N -M ,M ,K +J +I JLMNvOmOdO[PTROSJTFUCUAU">U*;U08U75U=3TD 1TK 0TT .T] -Uh ,Ut ,U+U*T)T(S(S'Q&P &O NOP|QrRiR_SVUPWIXDZ?[ <[9\7\'5\.2\40[;.[B,[J+[R)\\(\f'\r&\%[$[#Z"Z"Y!X!W VQSTxUnUeV[XSZL\E^>`8b4b1c/c#.c*,c1)c8(c@&cG$cP#cY"cd!cp c~cbba`^]]UVWtXjYaZW]O_HaAc9e1h+j (j&j$k%#k-!k4 k<kDkMkVkakmk{jjihgeedYZ{[p\f]^_TaKdDfGNU[`ejosx}%/9AIPV[`ejoty)3<DJQV[`ejou{ #-6>ELRW\afkqx~}|{yyy  '09@GMRX]bh~n}u{}zxwutrqppo ! * 3 ; B~ H} N{ Tz Yx _w evltsr|qonlkihggg ##" ~%|.y6w>vDtJsPqUp[namhkpjyhfecba`__^#&)(('$ }zw t*q2o9n@lFkLiRgXf^dec ma v` ^!]![!Z!Y!X!W!W!W!(,..-,}*y'w#s#p#m$&j$.h%5f%<e%Cc%Ia%N`%T^%[]&b[&jZ&tX'~W'U'T(S'Q'P'P'P&O&-0222~0x/t-q*m) i*f*"c**a*1_*8]*?[*EZ*KX*QW+XU+_T+gR,qQ,{O,N-M-K-J,I,I+I+I*14566z4t3o1k/g/c/`0]0&Z/.X/4V/;T/AR/GQ/MO/TN0\L0eK0nJ1yH1G1F1D1C1B0B0B/B/4799}9v8p6k5f4b4^4Z5W5#T4*R41O37M3=K3CJ3JH4QG4YE4bD5lC5wA5 @5 ?5 =5 <5 ;4 <4 <3 <3 7:;=z=s<m:g8a8]9X9 U9R: O9'L9.I84F7:E8@C8GA8N @8V >9_ =9i <9u :: 9: 89 79 69 59 58 67 67 :=>?w?o?i>b;]=W=S> O>M?J>%G>+D>1A=7?=>==E ;=L 9=T 8>] 7>g 5>s 4> 3> 2> 2> 1> 0= 0< 0< 0; =?A~BtBlBeA^@XARBNCJCGDDD"BD)?C/O :O8P6P$3P+1P1/P8-P?+PF*PO(PX'Pc&Po%P|$P#P#O"O!N M L KGIJtKjLaLYMOOIPCR=T7U3V1V/V -W(+W/)W6'W=%WD$WM"WV!Wa WmWzWVVUTSRQJL{MpNfO^PUQLSFU?W8Y1[,] (]&]$^$#^+!^2 ^:^B^J^T^^^j^w^]]\[YXXNPwQlRbSZTRUIXBZ;\3^,a$ceeee&e.e5e=fFfPfZef es e ddca`_ _R~TrUhV_WWXNZE]=`6b.d&gjlmm m m( m0 m8mAmKmUmamnl|lkkihgfWyXmYdZ\[S]J`Ac8f0i(k nqsu vvu"v*v2v;uEuOu[uhuwttsrqpo[t\i]a^X`OcFfEKQV[`ejpv}~~~ )19@FLQV[`flr~z|{yxwvutts ",3;AG~M}R|Wz\ybwhvouwsqpomlkjji  &|.z6x=wCvHtNsSqYp_oemlluj~hgedcb a ` ` ~ { w u )s 1q 8o?nElJkPiVh\fcdjcsa}`^][ZYXXX "##!zwuspm$k,i4g:eAdFbLaR_X]_\g[pYzXVUSRQQPP!%'((z'u%q"nl if c(a0_6^=\C[IYOWUV]U eS nR!xP!O!N"L"K!J!I!I!I &)+,|-u,p)l'h%e#b#_#\#$Z$,X$3V$9U$?S$ER$KP%RO%ZM&bL&kJ&vI'H'F'E'D'C&B&B&B%*-/0y0q0l.g,c*_)\(Y)V)!T)(Q)/O)5N);L)BJ)HI*OH*WF*_E+iC+sB,A,?,>,=,;+;+<*<*.02~3u3n3h2c/^.Z.V. S.P.M.%K.+I.1F.8E.>C.EB.L@/T?/]>0f<0q;0}91807060505/5.5.135{6r6k6d5_2Z2U3Q3M3J3H3"E3(B3.?24>2;<3B;3J:3R84Z74d55o45|35251504/4/3/302368x9o9g9`8[6U6P7K8H8 E8B8?8&<8,:8288868?58G38O29X19b09n.:z-:-:,:+9*9*8*7*669;u<l<d<]<V;P;K<F=B= ?><>9>#7>*5>02>61>=/>E.>M,>V+?a*?l)?y(?'?'?&?%>$=$<$;9<}=r>i?a?Y?R?J@EAABEKPUZ^ciou} !*29@FKPUZ_djqx}|{zyyyy$-4;AFKP~U}Z{`zfylxtv}usrqpoonn '}/{6z<xBwGvLtQsVr\qboinqlzkihgfeedc  |zw!u)s1q7p=nCmHlMjSiXg_ffdncwb`_]\\[ZZ|yvuspm$k,i3g9f?eDcJbP`V_ \] d\ lZ vY W V U T R R R Q }vroml i f d'b.`5^;]A\GZMYSWZUaTjRtQONMKJJJJ"#x#q"l hfdb_\#Z*X0W7U=TCRIQPOWN_LhKrI~HGEDCBBC"%|'t'm'g%c"` ]Z XUS&Q-O3N9L?KFIMHTF\E fD!pB!|A!?">"=!%c<&n;&z9'8'7'6&5&4%4%5$&)+v-m.e._-Z+V(R'N(K'I'F(D(&A(,?(2=(8<(?;)G:)O8*W7*a5+l4+x3+2+1+/+.+.*.)/)),}.s0j1b1[0V/R,M,I-E- B-@-=-":-)8,/6-55-<4.D3.L2/U0/_/0j.0v-0,0+0*0)/(/).)-,/{1p3g3_4X3R2M0H1D2@2<29272 52&22,133/3:.3B-4J+4S*4])5h(5u'5&5%5$5#4#4#3#2/2x4m5d6\6U6N6H5C6>7:768 3818/8$-8*+91)98(9@'9H&9Q$:[#:g":s!;!: ::997725u7j8`9X9Q9K9D:=;8<4=0= ->+>)>!'?(%?/$?6"?>!?F @O@Z@e@r@@@?>>=<6~8q:f;]<U<N<G=@>9@4A.B*C'D$E"E!E%E,F3F;FDFMFWFcFpF~FEEDCBA9z<n=c>Z?R?K@D@I6K/N(P!RTW Z ZZZ!Z)Z0Z9ZBZLYWYdYrYXXWVUTyElGaHXIPIIJBK:N2Q*T#VY[ ^`aabb$b+a3a=aGaSa_am`|`_^]\\tJgK]LTLMMFN=Q5T,X%Z]` cegh hijj&j.j7jAjMjYjgiwhhgffenObPYPRPJQAU8X/\&_behjmoopqrs s't0t:tFsSsasqrqpppohS^TVTOUFX<\2`)dhk nqsvwxyz{|} ~(1=KYi~{}|{{{cX[YTYJ\@a5e,j!mquxz}  '3BQas`]Y^OaDe9j/o$tx| (7HXi}_bTfIj>p2u'z '8J\pZkOoDu8{, *=PezUtJz>2% .DZoтҒҟ&0:CKSY_dinrw} !,6?GNTZ_dimrx~'1:BIOUZ_dhmsy#,5=DJPUZ^chmsz '/8?EKPTY^chnt|"+2:@FKPTY^ciow~~~~ %-4;AFKPTY^~d|k{ryzyxvutssss (/~6|<{AzFxKwPvUuZs`rfpnovnmljiihhh~{yw#u*t1s7q<pBoGmKlQkVi\hcfjesd~ca`__^^^ {xvs qom%k,j2h8g=eBdGcMaR`Y__]g\q[{YXWVUUUT ztp m ljhec'a-`3^9]>\DZIYOXVV]UeSoRyQONMLLKK|tmifdca^\"Z)X/W5U:T@S FQ LP SN [M dK nJ yH G E D C C B C xohc_][Z W US$Q+P1N7M=KCJJHQGYEbDlBxA?><;:;;~ t!k"d"^ ZWUSQNL J'H-F3E9C@BGAN?V=`<j:v98654344!{#p%g%`%Z$U"R OLJ GEC#A*?0=6<=;D9L8T6^5 h4!t2!1!0!/!- - -.#x&m(d(\(V(Q&M$J"G!C!A!>!,)G*)P)*Z(*d'+q%+~$+#+"*!*!)!)!(%~)r+g-^.V.P.J-E,@+;,7,4, 1,/,-- +-')--(-4&.<%.E$/N#/X"/c!0o 0}00//.--){,o.d0[1S1L1G0A0;06121.2+2)2'3%3$#3+"42 4:4B4L5V5a5n5{5544322,x/l1a2X3P3I3C3=46506,7)7%8 "8 99"9):0:7:@:J:T:_;l;z;::9 877/u2i4^5U6M6F6@7:729-:(;#=>???@&@-@5@=@G@Q @\ @i Aw @@?>== <3q5e7[8Q9J9C9=:7;/=*>%@BDE FF F# F* F1 F:FCFMFXFeFsFFEDCBB{7m9a:W;N<G<@=:=4?,A&C EGI L MMM M&M.M6M?MIMUMaMoM~LKJIHHv;h=]>S?K?D@>@7A0D)F"HKMORSTTT#T*T2T;TETQS]SjSzSRQPONp?dAYBOBHCBC;D3G,I$LOQSVYY Z[[\%\-\6\@[K[X[f[u[ZYXWVkC_EUELFFF?G7J/M'PSVX[^`` abcd!d(d0d:dFdSd`dpcba``_eHZIQIJICJ:M2Q)T!X[^ acfhij klmn"o)o3o?oLnZnim{lkjji_MVMOMHN>Q5U,Y"]adgjloprst uvxy#z+z7zDzSybytwvuut[RTRMRCU9Z/^$bgknqtwy{|} "+9IYkXVRWHZ=^2d'imrvy| !.>PbuW[M_Bd6i+oty}"2FXkRdGi=<<<;zof_ZVTRQ OMKI%H+F 1E 6C <B C@ J? R= [< f: q9 ~7644 3 2 2 vkb[UQNLJI GDB!A'?-=3<::A9H7P5Z4d2p1|0.-,+++~rg^ W QMIFDB@=;9$7*50463>1F0N/X-b,n*{)'&%$$%{o!d"[#T#N"I!D A>;8 642 0&.--4,;*C)L(V&`% l$ y" ! y!l#a%X&P&J%E%@$<#9!5!2!/!-!+!(!#'!*&"1%"9$#A#$J!$T $_%k%x%%%$##" v#i&^(U(N(G(B(<'8'3&0&,&)& &&$'"' !'' (.(6)?)H)R*]*i*w***)(('"s&f([*R+K+D+>+9*4*/**+&+#, ,---%.,.4.</F/P/[/g0u0/ / . - - ,}%p)c+X-O-H.A.;.6-0-*/%0!112 334"4)414:4C 4M 5X 5d 5r5443221z(l,`.U/L0E0>08030-1'3"4578 9: : :' :.:6:?:J:U:a:n:}:98876v,i/\1R2I3B3;35303*5$78:< > @@@@$@+@3@<@F@Q@]@k@z@?>==<r0d2X4N5F6?69636-7'9 ;=?BDE FGG G'G/G8GBGMFYFgFvFFDCBBm4`6T8K8C9<9791:*<#>ACE HJK LMNO$O+N4N>NINVNcMrMMLJIHh9[:P;G<@<:<4=-?%BEGJ LNQR STUV W'W/V9VDVQV_UnUUUSQPb=V>L?D?>?8@0C(F ILN QSVXYZ \]^_"`*_4_?_K_Z^i^z]]\ZY\BQCICCCELQV[_chnt{  )19AGLQVZ_diou}$,4<BHMQVZ_djpx '/6<BGLPUY^dkr{")07<BGKPTY}_|f{myvwusrsssrr ~}$}+|1z7y<x@wEuJtOsTrZp`ohmqk{ihggffff}ywtsrq%p+o1m6l;j?iDhJgOeUd[ccal_v^\\[[[ZZxspmj igf e&d,b1a6`;_?^E]J[PZWX_WgUrT}RRQQPPPxpjfda_ ]\[!Z'Y,X2V6U;T@SFQLPSO[MdLnJzIIHGGFF{qhb^[YWVTSQ#P(O-N2L7K<JBIIGPFXDaClAwA@?>=>> u kb\W T QPO MKJH$G)F.D3C9B>@F?M=U;_:i9v8765555 }qf]VQMKI HF ECA ?%>+<0;6:<8C7K5S3]2i1u0/----- ymbYRMHEBA @ ><:8!6 '5 -3 32 :1 A/ I. S, ]+ i)v'&$$ # " " vi^UNID@<:97 531/$.*,1+8)@(H&R%\#h"u sf[RKE@;7430. ,*( &&$-#5"=!FPZfs~pcXO H B < 730-*'$" #+2;DNYer {m` U"M#E#>#9"4"0!, ( $ !  !!!!"("0#8#B#L$W$c$p %~ $ $ #"" !xj ]#R$J%B%;&6%1$,$($#$%%& '''(&(- )6 )? )I )T)_*l*{*)('&&u f#Z%O'G(?(8(3'.')'%' ()*,- - - .#.*.2/;.E.P.\/i/x/.-,++q#c&W(L)D*<+6*0*+*')"*,-/13 334 4'4/484B4M4Y4f4u432110m'_)S+I,A-9-3-.-*,$-.024 68 99::$:,;4;>:I:V:c:r::8765i*[-O.F/=0601/,/'0!1357 :<= ??@A!A)A1B:AFAR@`@o@@@><;d.W0K2B3:343/2*3#479; >@BDE FHII%I-J6IAINH\HkG|GGEDB_2R4H5?68635-6&8:=@ BEGIKL NOQR R(R2R<QIPWPgOxOONLKY7M8D9<97819);!>AD GJLOQRTV WY[\$\-[7ZCZRYbYsXWWWTS<I<A=;<5<,?$BFJ LORUWY[]^` bdef'f1e=dKd\cnbaa``N@F@?@9@0C'GKO SVY\^acefhik noq q*q6pDpTofnymlkkKEDD>D4H+L!PU Y]`cfilnoqstvx z|"-~;~K}^|q{zxwIICH9L.Q$V[ `ehlosvxz|~ "/@Rg|HM=Q3V(\aglrvy} "3G\pCV7[,bhntz &;Qf{=a1g%nu { .G[p̃ɖ%.7?GMRX\afkpv}  *3;BINSX\afkqx%.6=CINRW[`elrz  (07=CHMRV[`fmt~#*17=BFKPUZ_fnw}{zxxyyx $+17~<}@|E{IzNxTwZv`thsqq{omlkklll}zxwuu&u,s1r6q;p?oDmHlMkTj[hcfkdvca`____`zuqnk jii i&g,f1d6c;b?aD`I_N]V\^ZgYqW|UTSTTTTxpjgca` ^]]!\'[,Z1Y6X:W?VDTJSPRZPbNmMxKJIJJJJyoga]ZXV UTSS"R'Q,P1O6M;L@KFJLHUG^EiCtA@AAA@@~sh_YURPNM LKJI#H(F-E2D7C<AB@I?Q=[;e9q8688777ylb Y S NJHGED BA@?#=(<.;3998?7F5O4X2c1o0}0//...t h ] UNH D A ?>< ;9865$4*2/150<.C-L,V*a)m({''&%&&p dYPID?;8 6 54 21/.!,&+,)2(9'A%K$U#`"m z{ m`VMF?:630.- , *( & % ## )" 0! 8 A J U an}    xi]RJB<62.+)'%# ! '/7@JT`m{    ufZPG?83.*'$!$,5>HR ^ j xrcWMD<50+'#  " ) 1 : DNZguo`TJA 9 3 -($   ! !!"&".#6#@#K#W#d#s$#"! k]Q G!>"6"0"+!&!"   !" $ & &'''#(+(3)=(H(T(b(p()'%$$hZ N"D$;%3%-$($$# ""#%' (+ ,---!.(.0/:/D.Q-_.n-~..,*)d!V#J%@'8'1'+&&&"%%&(* ,.01 3445%5-565A5N4\3k3{3310._%R'G)=*5*.)))%( ()+- 02467 9:;<"<*<3<==I;X:h:x99975Z(N+C,9-2--,(+#+-/1 468;<> @ ACDD&D/D:DECTBd@u@@@?=U-I.?0600/,.&.035 8;=@BDEG IKMM"M+M5MALOJ_IqIHHHGP1E2;343/1)2"47: =@BEHJLNOQ SVXX&X0X;WHUYSlRRQQPJ6@69635-5%8;? BEILNQSUWY[] _bc c*b6bC`S_f]{\\[ZF:=:7929)<@D HKORUXZ]_acegi lno#o/n<lLk^jsihgfB><=6=-@#EINRVZ]`begikmprtw z||'{5zDyVxkwvtsAB;B1E'JOTY^aeilortvxz|~ *:L`vAF6J+P U[`fkosvz},?Tj;O0U%[a hnty}2G^s5Z)ahnv|$;Sh}ȏ "+4<CJOUZ^chnt{&/7>DJOTY]bhnu} !)18>DHMQV[agnv#+28>CGKOTY`hoy|{ %,28=AFJNSY`}i{rz}xvtsrqpo~}}}&{-y2x7w<v@uEsIrNqTpZoamlkwigfedcdc~ytrp onn!n'm,k2j6i;h?gDfIeOcUb\ae_r]~[YWWWXYyrkhecb bbb"a'`-_2^6];[?ZEYJXQWXU`TkRyPNLKKNNyofa]ZYX WWWW"U'T,R1Q6P:O@NELLKSJ\HfGtECA@@CD}qf^WSQONM MLLK"J'H+G0F5D;CAAH@O?X=b<p:~8779::vj_VPLIGEDC BBA@">'=+;0:68=7D6L4U3^2m1z0/.012~pdYQJEA>=;: 98753"2'1,01/8-@,H+Q*\)i(w'''(((zl_TL E ? ;75320 /.-,*#)((.'4&=%E#O"Z!g u vg[ P H @ : 5 1 . ,*)( '&$#"% + 2:CMXesrd W MD<61-)& $ " !  "(/8ALWdrn ` TJA93-)%!       & . 7 A L X dr    k ]QG=6/*%!    $ , 5>ITao~hZND:3-'"   !(1;EQ^m}eWKA80*$   &.8CN\k{bTH>5.'"   !!!#"+"5#@#L"Z"i"y!!!^QE:2+%   "$ & ''(!()(2(=)I)V'g&x&&&$"ZMA 7!/!(!#  !#%'*, .../&///:/F0S.d,v,,++(VI!>#4$,$&#""! !# %'),.02 4566$6,777B7O6`4r22111Q#E%:'1'*&%%!$#%' )+.0357:< >?? ?(?3?>?K?ZACEHJLN QSS S)S5SBRPOdMxKJJIB08100,.&.147;>ADGJLOQSUWZ ]__$_/^<^K\\YrWVUT=45402*2!59<@DHKNRTWZ\^`cfi lnn'm5lCjTgjecba:847/6%9>CGKPTWZ]`begilnqtx {| {-z<xLvatxrpo9;4;)>CIOSW\_cfiloqsvx{} $3DYp9?.C#IO U[`dhlptwz} (9Mc{3I(NT[bhmrw{ +@Vm-T![ahov} 1H`uƈ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭICC_PROFILE ŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:?=DcILϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:>C5HWP|X_ѭtǬǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ0>C4GWP|X^ѮrǭǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ1>B4GWO|W߳]ѯoȭȮǯǯƯƮŮŮŭŭŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN|Vߴ\ѰkȭǯǯƯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN{UYӳcȮ~ǰƯůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1<A2EUM{STԹVȯxưůůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1;@1DTKzRLIƲuŰįįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ1:?0CSJyM=PĸnñįįĮĮĮĮĮĮ29=/BQHwA5Ukx辶븵쳴}}|荒}勉~勉勉勉勉勉勉勉勉勉勉勉勉勉勉勉16;,?NCr,;Wüiμtպyڲvޫuॺt⡹s䝹t囹u暸x暹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{-37);J+s5BWfoɭnϥmӞm֘lؔlڑnۏpۏsۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏv'- 1&'O2s?JVbbcÕcȏcˊd͇fυhЄkЄnЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄr" !-,R:nEOUVWYZ[}^{`zcyfyjynynynynynynynynynynynynynynyn$13N?dJvONMOPxRtUqXo[n_nbnfnknknknknknknknknknknknknknknk+07ECXHjGyGGzHrKlNhQfUeXd\d_dcdhdhdhdhdhdhdhdhdhdhdhdhdhdhdh ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMXnbkrܩyթЪͨʦȥǥǦǧƨŨĨĨĨĨĨĨĨĨĨĨĨĨĨĨ <H-MMXnajp۪wԪϪ˫ȪƫƬƬƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ <G-MMWnain۫uӫ~ͫɬƬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭ <G-MMWn`il۬sӫ|̫ǬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G-LLVn`hkڬqҫ{˫ǬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G,LLVn_giڭoҬyˬǬǭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,LLVn_fgڮmҭwʬǬǭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,KLUn_efۯjҭuʬǭǭǭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F,KLUn^cd۱gҮsɬǭǭǮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+KKTn^bb۲dҰoɭȭǮǯƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+JKTm]``ܵ_ӲjʮzȮǯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm]^]ݹ[ոa˱qǰ|ƯůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm\[YUֿUʶhŰůįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ ?E*IJRmYWTMVǹlij}įįĮĮî?D)IJQlURMD[ün·zµﺲ񴱀򰱁󯱃򯲅򮲈񮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊>C)HIPlOM8J_oٿy߿䷸|箶z騵y뤵z좵|좵룶ꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶ=B'GHMjJu98ObȼoѼx׵w۫uߣs᝺s㚺t䘹w䘺{䘺㙺♺♺♺♺♺♺♺♺♺♺♺♺; @&EFG_:p7?RcoȱpΨoҠm֙mؔmڐnۏqێuێzڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}9 >$CD;O4s=GUcfeęeȒe̍eΉgЇhцkхoхsхvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅv6 ;!:5.T9rDNXYZ[[\]_}a{dzgzkzozozozozozozozozozozozozo16&53U?nJRPOQRTzVwXuZs]r`qdqhqlqlqlqlqlqlqlqlqlqlqlqlql(+79QEfKuJJJJyMsOoQlTjWiZh]hahehihihihihihihihihihihihihi !15?JD[CjCwD~EuFmHhKeNcQbTaX`[`_`c`f`f`f`f`f`f`f`f`f`f`f`f`f'6.;?;P;_=l}>ws@jBcE^H\LZPYSYVYYX]XaXdXdXdXdXdXdXdXdXdXdXdXdXd.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`c{josyޜ}ڗדՎԋӊӋӌӍя̑ȓȓȓȓȓȓȓȓȓȓȓȓ. @%MBZ`c{jptyݢ}ٞ֙ӓҏэюяѐ̓ȕÕÕÕÕÕÕÕÕÕÕÕÕ. A%MBZ`d{korwݨ~ؤ՟ҙГϑϑϓ̕ǗØ俗俗俗俗俗俗俗俗俗俗俗俗/ A%NBY`c|impuܩ|ةԤўϘΔ͔͖Ǚě輙缙缙缙缙缙缙缙缙缙缙缙/ B$NAY`c|hknrܪyةөФΝ̘̘ɚŜ뽜뺛깛깛깛깛깛깛깛깛깛깛깛/ B$NAY`b|gilpܫvת}ӪЩ͢˜ʛƞ 췜췜췜췜췜췜췜췜췜췜췜/ B$NAX`b|ehjmܬt׬zӫϪ̨ʡɟĢ񼡒𹟓ﶝ/ C$MAX`b|dfikݮpحwӬ~ϫ̫ɦȢ¥󻢐򷠒𴞓/ C#MAX`a{cegiݰmدtӮzϭ̬ȬƧ󵡑񲞓ﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞ0 C#MAW``{aceg޳hٳoԱvа|̯ɮƭ򯟒𯞒ﯞﯞﯞﯞﯞﯞﯞﯞﯞﯞ0 D#L@W`^z`acd߸e۸iֹpӹvθzƳ𻯆򫟒𫞒﫞﫞﫞﫞﫞﫞﫞﫞﫞﫞0 D#L@V_]y^_`abciξrƸ{´󭬐󪦐󨢑񦟓烈烈烈烈烈烈烈烈烈烈烈0 D#L@V_[w\]]^__jǽt¹}徵쬲񬳈𨳏𥬒𣦒0 E"K@U_YuYZZ\U_l¾vܿ~㵷}馴|젵잭윦윥윥윥윥윥윥윥윥윥윥윥1 E"K?U_WsVVWQSbnҿxڼ~ହy堷x鞷頷螸瘷藮藭藭藭藭藭藭藭藭藭藭藭1 F!K?T_SoR{SMFVdƽpлxײxܤtᚹu䘹|䙺㚺◺⑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺2 F!J>Q\OiNrJAIYgĹq̵vӨr؜pܔrߒwߒ~ޔݕܐݐݐݐݐݐݐݐݐݐݐݐ2 E J>LVK_Hg=CL\hoȨnΞmӔl׎nٌsٌyٍ؎׏ՏՏՏՏՏՏՏՏՏՏՏ 3 DH=HLEO9l?GP^hgœfȓf̌gЇjцn҅s҆yцŀЇňχňχňχňχňχňχňχňχňχňχňχň 4BG;A=3Q;nCLT]^__`ăbd~h}m}r}y~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ 6@@,+55U>oHQUUVWXZz\w_vbufukuquxuxuxuxuxuxuxuxuxuxuxux7=,.:9UCkM|PNMNOyQtSqUnXm\l_kckhkokokokokokokokokokokoko3- #1;>RHeIsGGG{HtIoKkMhPfReUdYc\cacgcgcgcgcgcgcgcgcgcgcgcgپ+ )!68BK@\?i@tA}yBqDjEeGaJ_M^P]T\W\[\_\e\e\e\e\e\e\e\e\e\e\e\e -726B7Q9^;jw{f@`B\EZIXLWOVSVVVYU]UcUcUcUcUcUcUcUcUcUcUcUc # &*)-80F2Sv5_l7hc:o]=tX@xUDzSH|RK}QO}PR}PU}OX~O\}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb} " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYla~glqw|၂|zzz|}~ڀԃ΅ͅͅͅͅͅͅͅͅͅͅ " 5B9OSYla~glpv{ށ}|}ۀڂӅΈȈLjLjLjLjLjLjLjLjLjLj " 5B8OSYla}glpuz݆ہڀځڃӆΉȊË " 5C8OSYka|hmqtz~܋څق؂؄Շ΋ɍÍѾѽѽѽѽѽѽѽѽѽѽ " 6C8OSZkb{inqty~ܑى؅քׇϋʏďԾԺԹԹԹԹԹԹԹԹԹԹ # 6C8PSZjbzhlptx}ܗُևՆӉʏĐ׾׺׶ֵֵֵֵֵֵֵֵֵֵ # 6C8PSZicyfjmqu|ܞٕՊԈ͍Œپڹڵٲرررررررررر # 6C8PS[hawdhkosyݦٝՏӉǑܾܸܴܱۮڭڭڭڭڭڭڭڭڭڭ #7D7PS[f`vcfilpuޫ|ڧ՘ҋ߿߷߲߯ެݪ۩۩۩۩۩۩۩۩۩۩ #7D7QS\e^uadgjmqxܯֿ֤ⴕ⮕⫔ᩔ৓ޥݥܥܥܥܥܥܥܥܥܥ #7D7QS[d]s_adgkouݿyɰծ㤗棖壕㢕⡔ࡓޠݠݠݠݠݠݠݠݠݠ #7D7QSZc[q]_bejqqsƼ{Ԡ␣薚昗嚖㛕ᛔޛޛޛޛޛޛޛޛޛޛ#8E7QRXaYoZ{]`dllpuųyӓz㐨㑟㒚㓗ᕕߕޕޕޕޕޕޕޕޕޕ#8E6RPV_WlXwZ_feipvíxюuތދތߍޏޏޏޏޏޏޏޏޏޏ$8E6RNS\ThVrYx_zZ\dltŤsэsڍڏ؇ډ܉܊܊܊܊܊܊܊܊܊܊܊$9F6QKQXRbTiXkPTXbkpŚnϊp։~֋Պ˜Ճօ׆؆؆؆؆؆؆؆؆؆؆$9G5OGOROYQ\IoMRXbkjĒi͇m҅x҆ĄчŐЅŚЀĦҁӁӁӁӁӁӁӁӁӁӁ$:H5MBLJKLB\GtLRYceeeɂìr̀}́ȇ˂ȑʀȜ{Ǩyǫyǫyǫyǫyǫyǫyǫyǫyǫyǫ%;J4J;G=>FAaGwMS[^_`a}ezm{v{|ˈ}̒|̞z̠z̠z̠z̠z̠z̠z̠z̠z̠z̠%<H,D/C!925:OCfKxSRQRS{UuXq\obnhnonvo~oՈoՋoՋoՋoՋoՋoՋoՋoՋoՋoՋ&A8&49=QFeOuMLLLyNsPmSjWh\gafggmgug}ggggggggggܯ'8  *!6:AOHaFoF{FGwGoHiKfNcRaV`[`__d_k`r`t`t`t`t`t`t`t`t`t`tڲ' /#:9?J>Z>g?q}@ztAmBfDbF^I\MZPYTYXX\XaXhXiXiXiXiXiXiXiXiXiXi׶ %3!435C5P7\z8fq:njqSAsQDtPHuOKvNOvMRwLVwLZwK`wKawKawKawKawKawKawKawKawKawKaw ""/w&;m*Fd-O\1WV4]Q8aN%J*H,F)B;IRNfRxVYXZ|\rcoppqҏrӝpӪkиm·nnnnnnnnn/@F @7)AAGWLjQzUTSVuXm_kikvlՃl֐mלmتgֻfԽfԽfԽfԽfԽfԽfԽfԽfԽ0C=)8/@FG[MlP{OOOxQoUiZfcfnfygڃgێhۛhܩhܭhܭhܭhܭhܭhܭhܭhܭhܭ1= '-93AIH\KlJyJJyKpMiQdVb^afaoaxb߁bbbbbbbbbbb/% 0 ;6BIEZDiDuEzFqGhIbL_R]X\^[f[n[v[\劘\匘\匘\匘\匘\匘\匘\匘\匘\匘%4"=6ny@vpA~hCaE\IYMXRVXV]UdUjUrU|U~U~U~U~U~U~U~U~U~ܫڸ+3!223A5O7Zw8dn:lfwZAzVE}THRMQQPVP[O`OgNoNqNqNqNqNqNqNqNqNqٰ"&',*:~-Et/Ok2Xc4_\7dW:hSR@BS>ES=IT:GGNUUc[pa|govxnhfghmsévĩxêyëy«z«z«z«z«z«z«z«z«z«"2)=9FENSU`[m`zfl}uskghjqx¬yz{||||||||||"2)=7FCNPU^[j`vekr||qlmpu{|}~~"2(<6FAONV[\gasf~kqz|srtx}"2(=4G?OKWW]cbogykqݓz҆{xy|"2(=2H=PHXT__cjgtl~ߥp՚wʐ}~~"1'>1H;QFZP^[bdfmjv٫l΢t™{"1%>/I9SBYL\U`]eeݸduұiǩqw~ēđđÑ"1$>-J6T?WGZO_Ub_׿^s˷fmtzDŽȃDžƇĈ‰"1"?*K3T;UBXG^JY]\qľcjpv{}wv{}ŀÂ#2 ?(L/R6S;V=YDQ[Yo`flqvu~pouwxz|||||||||#2@$N*O/P1T0LAPXVm\bgk|pn{kjoqstvvvvvvvvv#2A L$K&L%M&P?RVTjX|]aerjgxfeĪilnoqqqqqqqqq#3BHEBI-P@USXgXyY[x]hcbu`ԍ_רaehjlllllllll$3C@: =G4MGRZUkTzS}SnVc_`pa܅bݚcޮ`Ħaĩcëfffffffff# 3 ? 1/=%F9KLP^OnM|NvOiRa[^h^y^_ᛠ_᭟^⿞]ɡ_ȣ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ"0.2>*E>KPI`HoH{{InKcO]V[aZnZ|[䋚[嚘[樗[準ZʘZ˘Z˘Z˘Z˘Z˘Z˘Z˘Z˘"# 4?.EACQB`Bm}DxrEgG_LZRW[VeVqV}V鉑VꖏV뤎V붍V췍V췍V췍V췍V췍V췍V췍V췍 ) 7=0hs?riAz`DZHVNSUR]QfQpQ{PPPPPPPPPPPѽ,24/4>4K|6Wr8ah;i`=pY@uUDxQJ{OP|NV|M]|Le|Kn{KwzJzIyIyIyIyIyIyIyIyIyҵ"')+*8z-Dp0Ng2W^5^X8cS\^=c^;K=?L;CM9HM8LM7QM6VM5]M5]M5]M5]M5]M5]M5]M5]M5]Mzo d[ T"M)H/D"3@'7<+9:/;83<67=5;>3??2D?1H?/M?.R?-Y?-Z?-Z?-Z?-Z?-Z?-Z?-Z?-Z?vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{ws lg.&`=8dFEdNRaX_]ajWksSuyP}ONNNOPPQȀSWZ~]~_}a}a}a}a}a}a}a}a}xt ni.%e<7jDDjMQgU^b_j\isVs{S|QPPPQQRS˃VσZ҂^Ձ`؁cۀc݁c݁c݁c݁c݁c݁c݁c݁yu ok-%j;6oCBoKOlS]g\iafs[p|VzSRRRSSTŬZφ^҅aՄd؄eۄf݅f݅f݅f݅f݅f݅f݅f݅zv pl-%n94tBAuJNrR[mZhgds_n|YxUTSTTUVÊYˉ]Ήa҈eՇfهgۉhۉhۉhۉhۉhۉhۉhۉhۉ{w rn-%s83yA?zILxPYsXflarek|^uXVUUVWXƍ]ˌaόeӋh֋iٌj؍k؍k؍k؍k؍k؍k؍k؍k؍|x tp-$x71~?=GIOWzVds^plh{dr]}XWWWX[ǐaːeϏiԎk֐lՑmՑnԒnԒnԒnԒnԒnԒnԒnԒ}z uq,$}5/>:GGNTUa{\mseykoby\XXZ\_Ȕe̓jђlӓnҔoҕpҖqіqіqіqіqіqіqіqі~{ vu+#4-?8GDNQU^[j|bvsljvb^^`bdǗjΖnіoИqϙrϚsϚsϚsϚsϚsϚsϚsϚsϚsϚ~| xy*!4*?5HAOMUZ[gas|i~tsk}edegiěmΛqΛs͝t̝u̞v̞v̝v̝v̝v̝v̝v̝v̝v̝}y})4(?3H>OJVV[bangz~quzmijkmpˠtˠvʡwɡxɡxʡyʡyʡyʡyʡyʡyʡyʡyʡ~z(5&@0I;PFVQ\]aiguߊp׀xvpoprtǤxǤyǥzǥzǥ{Ǥ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{(5$@.I8PBVM\Xacgnْo}ωu|wtuvxĨ{Ũ|Ĩ|Ũ}Ũ}ŧ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ|(5"@+I4Q>WG]Qa[ۢejҙl{ȑszzy{|~¬~¬«ëĩĨĨĨĨĨĨĨĨ}(5 @(J1R9XB^JaT֧bh̠jy˜qw}~¬êêêêêêêê~(5@%J-R4X;\B۳YRЭ`fƦgwnuz¬¬¬¬¬¬¬¬(5A"K(S/V4X:չUP˲]deulrx}~(5AK#Q(S+O8оSNŸ[bbsioty}usruxz|~~~~~~~~(5ALM PG6PKX`_qekput|lkjnprtvvvvvvvv (5AIHBE3NIV]\ob~gk{pmxgfeiklnoooooooo ' 4@B> 7B0KFRZXl]{bfrjftba`cŧfĩgëi¬j¬j¬j¬j¬j¬j¬j¬j¬& 2 =5-=E-IBNVThXx\w_ie`q]„\Ě\Ʋ]˟`ɢbȤdǥeƦeƦeƦeƦeƦeƦeƦeƦ$.01 @J+O>ORPdSt{UmX`_ZnXӂX՘WرWіZИ\Λ^͝`̞`̞`̞`̞`̞`̞`̞`̞4@H1KCLTLdLrpNcQYZUiT|T摏T觍SŒVҍV֐XԒZӔZӔZӔZӔZӔZӔZӔZӔ  $7A$E6EFEVFduFpgH{[LTTQaPqOONNQӃS؅T܈T܈T܈T܈T܈T܈T܈T܈ ҹ+8<(>8?G?Uw@bkAl_BuWH|QONZMfLtKJ~J|J{IzOyOyOyOyOyOyOyOyԱ) 15)788Fx8Rl9\a;fY?mRDrNKuKSvI]wHhvGuuFtDsDrDqDpDpDpDpDpDpDpDp֪ʺ" )-(/5w0Ak1Ka3TY7\R;bM@fJFhGMjEUjD]jBgjAri?~h>g=g=f=f=f=f=f=f=f=fڣ̴  $#u&/j(9_*BW-JQ1PK5TH;XE@ZBF[@L\>S\<[\;d[9m[8wZ6Z5Y5Y5Y5Y5Y5Y5Y5Yή½ |rg']0U#7N'=I+BD0EA4H>9J<>K:DL8IL6PL4VL3^L2fK0oK/xJ/xJ/xJ/xJ/xJ/xJ/xJ/xJĸwm c YQ$J*E/@$3<(69,871955:3:;1?VI\U܋fbԁmrxtq|mlmnopӔrӔtҕtҕuҔuӔuӓuӓuӓuӓuӓuӓuӓtq l} ,7A%I/P8VBߙ\M֒c_͉kpŁq~yxsqqrst˙vϙwϙwИxИxїxіxіxіxіxіxіxіuq o +7A!H)O2U;ڟZIјb]Ǒimo|v{}wvwwxĝy̝z͝z͜zΛzϚyϙyϙyϙyϙyϙyϙyϙvr r+7@H$O+ߪT3դWG˞`Z—gkmzsy}zz{||ɡ|ʠ|˟|̞{͜{Λ{Λ{Λ{Λ{Λ{Λ{Λvs u  *6?GN$ڮM1ЩUEƣ^Xeilxqw}~ǥȤ~ɢ~ʠ}˟}̞}̞}̞}̞}̞}̞}̞wt x  * 5>F߳LճI/ˮSC[Vcgivoty}{zĩ|Ƨ~ǥȣʡʠʠʠʠʠʠʠxu {  ) 4 =D۹CѸG,ƳQAYT`egtmrv||tqonêqĨtƧvǥxȣyɢyɢyɢyɢyɢyɢyɢyv  '2 : ? 9̽E*O>WQ^bdrinstyjhgf§iƧkƦnǥpȤqȣqȣqȣqȣqȣqȣqȣzw %.426C'L;TN[`aof}jzoludcbadɢfɢgȣiɢjɢjɢjɢjɢjɢjɢjɢ{x !'߾%3@$I8QKW\]laz~fqjer_^^]_Λa͜b̝d̞d̞d̞d̞d̞d̞d̞d̞|z . < F4MGSXXh\vv`ie_n[}ZYYYԒ\Ӕ]і_З`И`И`И`И`И`И`И~~ ڰԾ. 9B/IBNSScyVqlZ~`_YkV{VƎUȣTɼT݇VڊXٌY׎Z֏Z֏Z֏Z֏Z֏Z֏Z֏  ۨҵ5 ?E*G~DMqF[dHgYLqRUvNbxMrwMvLtLsKqLqMtNwOxOxOxOxOxOxOx̵֧ %06":1Lg@W\BaSGiMOnIZoFgoEwnCmCkBjAiEhIhIjIjIjIjIjIjIjڟͯü" +0#30t6=i7H^9QTjd]>]>]>]>]>]>]Щŷ #}(!s,-h.7^0AU3HM7OGJX;SX9]X6iX4xW2V0U0T/S/S/S/S/S/S/S/SӣƲ ypf#&\&/S)7L,=E0B@5E<;H9BI6IJ3QJ2[J/fI-sI+H)G'G'F'F'F'F'F'F'FɮukbYQ%I!+C%0=)48-753939:0?;.F;+N;)V;(`;%j:#u:!9 9 9 9 9 9 9 9|rh^ UM F?9"4%0#'.(),.*)3+'9,$?,"G, N,V+^+h+n+n+n+n+n+n+n+|oe[R IB;5 1.+( &"!$&!!+!0!6 < BIPUUUUUUUY PE#:0!=6%A@0AJ:>UC;`I8mM6zP4Q2R2R2R2R3R3R3R3R4Q9Q=PAPDOGNINININININININZ QF"=.!A3%E=0EH:ARC>^K:jO8wR6T4U4U4U4U4U5U6U6T8TZ?YDYHXLXOWPXQZRZRZRZRZRZRZ] UJ!I(O-"S7-SA8PLCJWMDbUAnZ?{]=^=^>_?^@^A^B^C]D]H\L[P[R\S]U^U^U^U^U^U^U^_ WL N%U+ [6*[@6XJASTLL_VGk]Dw`CbBbCcDbEbFbGaHaI`M`Q_T_VaWbYcYdYdYdYdYdYd` XNT#\*c4(d?3aH?[RKU\UNg^JscHfGfHgIfJfKfMeNeOdRcVcXeZg[h]i]i]i]i]i]i]ia ZPZ d(k3$m=0jF;eOG^YSWc^QneNziMjMkOjPjQiSiThUhXgZi\k^l_m`nananananananc \T`k'r2!u<,tE7oMChVPa`\YjeTvkSnSoTnVnWmYlZl[l\m_o`qbrcrdsdsdsdsdsdsdsd ]Xfq&y1|;'|D3yL>rTKj]Wbgc\rlY}qYrZr[r[r\r]r^s`scudvewfwgwgwgwgwgwgwgwe ^]lv%0:#C.K9|REu[Rne_fnj`xs^w^x_y`yaybycydyfzh{i|j|j|j|j|j|j|j|j|f`bp{$/9B(J3Q>ZKycYpkhitte}{c~d~eefghj‬kဨlဥmဣm•mmmmmmgafu $ .8A#I,P7ۊZD҂aVzifrpslx}iiijklÄlۄnޅoޅpޅp߄p߃p߃p߃p߃p߃p߃p߃hb j x # -7@H&ޖO/ՐWẢ_SĂgcznqtu}o}nnnoppԉrۉrۉr܈r܈r݆r݆r݆r݆r݆r݆r݆hc m | " , 6?FڜM+ЖV?Ǐ^Pealo|r|vysrsstt͎u؎u؍uٌuڋtۊtۉtۉtۉtۉtۉtۉid p  * 4<ޣCՠJ)˛T<•]Nd_jmpz}vy}vvvwwǓwԒwՑw֏w؎vٌvٌvٌvٌvٌvٌvٌje s )1 9 ڨ=ХH'ǠS:[Lb\hknxs~y{yzz{zіzҕzԓyՑy֏y֏y֏y֏y֏y֏y֏kf v&.4֬9̩G$¥Q8YI`Zgilvqv}}~z~x~wv~Κx}Иy|Җz|Ӕ|{Ԓ|{Ց|{Ց|{Ց|{Ց|{Ց|{Ցlg y"(ۯ,Ѱ7ǮE"O5WG^Wefjtnszyromkk͜nϚpИrіt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕmk }ֵ!̵5²BL2UD\Ubdgql~psui~edccϙeϙgИjїlҕlҕlҕlҕlҕlҕlҕnn ڲ йƺ2 @J/RAYQ_adni{xmlsc}`__^Δ`ҔaҕcҕeӔeӔeӔeӔeӔeӔeӔos   ׬Ѷʾ/ =G,O=VN[]`k|ewpiep^{\[[Ž[؍]׏^֏_֐_֐_֐_֐_֐_֐_֐px إаʻ*9C'K9RIWX[ft`shd~^lYyXWVV˃VބX݆Y܈[ۉ[ۉ[ۉ[ۉ[ۉ[ۉ[ۉr~ڞѪʵ $4?#G4MDRSvVakZn`_xXh~UvT~S}R{QyQzS}TVVVVVVVtӤ˯º. :B.H>xLMmP[bTgXZpRetPttOʅsO̘qNͬoMnLnMqOtPvQvQvQvQvQvQvw؝ͪĶ / 8>){C8oFFdJSYN^RVeNbgMqgL܂eLޔdKߨbJaI`GdIgJjKjKjKjKjKjKjݕϤű ,3{8*p;7d>CYANQGVKO[GZ]Fh]Ew\D[DYCXBVBUBWD[D[D[D[D[D[D[ӞǬ&z-p1)e54[8>R;FKAMEIQBRS?]S=jR;zQ:P9O8N8L7K;J61,' #!$*07 ? GOYZZZZZZI@5&2/44"2=%2H-0S4-`8+n;*{=)>(?)?*?+?+?,?-?->.>/>0=2<6<9;;;<<<<<<<<<<<<=>>????????????LA7%8*:/!:8%:C.8O65[<3h@1vB0C/C0D1D2D2D3C4C5C6B6B7A9A=@?@ABBCBCBCBCBCBCMC8%<(?, ?5$@A.>L7:X>8eB6rE5F4G5G5G6G7G8G9F9F:E;EDBCCEEFGGGGGGGGGGGGND;$B%E)G3#H>.FJ7AU?>aE;nH:{J9K:K;K;KJ?I@IAHBHCGFHHJJKKLKLKLKLKLKLP E@!G"L'O1!P<,MG6IR@E]GAjL@vN?O?O@OAOBNCNDNEMFMGLHKHLKNNPOQPRPRPRPRPRPRQ GEMU&X/Y:)VD4RO?LZHHeNFqRE}SESFSGSHSIRJRKQLPMPMPNSQUSVTWUWUWUWUWUWUWS IJT\$a.c8%`B0[L&pG2iP>c[J\eUXp]V{`VaWbXbXbYbZbZb\c\d^f_g`gahbhbhbhbhbhbhW OZh q! w({3|= yE+tN7nYDgbQak]]ud\g\h\i]i^i^i_i`iajblcldlelelelelelelelX P_ m v }' 1;D$~M0yW=q`Njh\dpgazlanaobobococpdpepfqgqhqhqipipipipipipY Tc q {% /8AڇL(сU:z^KseZlmghuof~sfufuguguhuhuiujvkvkukuktktktktktktZ Wg u$, 6ސ?ՍJ%̈T8Á\H{cXtjeoqplyvjyjzkzk{l{l{m{mzmzmymxmwmwmwmwmwmw[ Z ky!)2 ږ<ВH#ǍR5ZFaU|hcvnoruxp~}onoooppp~p}p|o{o{o{o{o{o{\ ] n|%ߚ-՚9˗G “Q2YC`Sfa}lnxrxtyrrrrrsфs߃rrငrq~q~q~q~q~q~] ` q  ۟&П7 ǜEP0XA^Pe_jlowzuv~uuu~v}vˉ|v܇}uޅ}u߃~t~t~t~t~t~t~t^ c u ֣"̣5  CN-V>]Nc\himur{y{yxyvytzrzƌrzڋtyۉux݆vwޅwv߃wv߃wv߃wv߃wv߃wv߃^ f x ܡ Ѧǧ3 AL+T;\KaYfgksp~xuq~m~k~igg؍j}ڋl|ۉnz݇oyޅoyޅoyޅoyޅoyޅoyޅ` j{  ٜԥ̪«1?J(R9YH_Vedip{m|qrhzcba`_ًbڊdۉf܈g~݇g~݇g~݇g~݇g~݇g~݇anڗӠͨŮ.<G%P5WD]Sb`gmukyjpax^]\[Z܆\݇]݇_݆`݆`݆`݆`݆`݆`݆br՛Τǭ*9D!M1SAYO^]ycinhudm~\wZYXXW~WXZZZZZZZdwٕРȩ %5 AI-PjOK`TWWZ`QceOpfMeMdL£bKøaK_HaIdKgLhLhLhLhLhLhyތњƧ. 8v?)kD7aICXNNPUUL_YJmYI|XIҍVHӠUGԶSFRESCWEYF[F[F[F[F[F[֔ɢ~* u2k7$a<1WAL>L>L>L>L>Lݍ͝ª |s$ k+a0"X5,O:5H@;CH@@QA>]B8<8;7:6:6<6<6<6<6<6<Ҙŧx ph _#W(O-%G2,A91=@49H66R64]62j60y5/4.3.2-1,0,0,0,0,0,0,0ȣuld \ TME$?*"9/%56'2=)/F*-O**Z)(f)&u(#'"'"&!% % % % % % %th`XQ IB<61$.**1 '7 $? !HS_m|tg\TLE >71 -(%"#(/6?I T _lxtg[PH@8 2 -'#  $*2<EOY``````;0&+)-)3&; "F""T$"a'"o*!{+ ,!,",",#,$,$,%,&,&+'+(+)*))*)*(+*+*+*+*+*+*<1(),+,0*9!'D#'R&'_)&l,%y-$.%.%/&/'/(/(.).).*.+-,--,-+.+-,0-0-0-0-0-0-=2+'0(0-/6!-B$,O(,\,+i/*v0)1)1*1+1,1,1-1.1.1/0001/1/2.2.20515151515151>30$4%6*63 5?$3L*2X/1e20r3/~4/50505152434344453636272816385;6;6;6;6;6;6@55 :!<&>0=<$;H+9T17a56n75z858697978889898:7;7<6=6=5<7<9?:A;A;A;A;A;A;A7:AE$G.E9#DE+@P3>\8<>I>I>HAHCIEKFMGMGMGMGMGMGD;FOV!Z*Y3V>&RI1MT:I_AHlDGwEHEIEJEKDLDMCNCNCNCOENHMJOLQLRMRMRMRMRMRME@LW_ b(c1a;!\E,VP8Q[ANgGNsIN~JOIOJPJPJQKQKRKRKTLSOSQURVSWSWSWSWSWSWSGER^ f j&k/k9gC&aN2\X>WcGTmMSxPTQTRURURVRVSWSWSXSXVXWZX[X\X\X\X\X\X\XHJW d l q$ s,s6q@mL+gV9`_G[hQYrVY|XYYYZZZZZ[Z[Z\Z][]\]]^^_^`]`]`]`]`]`]IN\ irw"z) {3z=wJ$qT5j\DdeQ`mY^w^^`^`^a_a_a`a`aaaabbccccbcbcbcbcbcbcbK R a nv|&/ ڃ<~H!yR2rZBlbOgiZdrac{ecfcgcgdgdgdgegehfhfgfgffffffffffffL U e rz"߈*Ո9̅FÀP/zX?t_MofYknchvhgkglglhmhmhmhmhmimilikhjhjhjhjhjhjM Y i u~ڍ%Ѝ7 NJDN,W<{^JvdXrkcnrjlzokqkrkrkrkrkrkrkqkpkokmkmkmkmkmkmN \l x Ց"˒5 CM)U9\H}bUxhatokpvrnunvnwnwnwnwnwnunsnrmpmpmpmpmpmpO _o| ّЕǖ3AL'T7[EaS~f_yljursrzxq{q{}q{{q{yq{wq{wqyxqwypuyosyosyosyosyosyosP br؎Ԕ̙š1@J$S4YC_Pd]ii{or}wuzxu~uusuquoumunu|otzqsxrrvrrvrrvrrvrrvrrvS evڊԒϘǝ/>I!Q1X@^McZgf~lqu}rznzzjyhzfzezc{΀dz~fx|hwzjuxjuxjuxjuxjuxjuxV iy֎ϕɜ,;FO.V=\JaWecxjnnoyfva_^]\~\}^~|`|{bzzbyybyybyybyybyyZm}ۈҒʙà(8 DM+T9ZG_S|c`rhkhlu`t|[Z~Y|Y{XyVyXyZy[x\x\x\x\x\x_r֍͖Ş $5 AJ'Q5WB~\Oua[lfgbkp[svWxVwVuUsTrSrTsUtVtVtVtVtVtVtdw݆ёț0=F"M0S>xXJn]Veba\hjVqnT~oSnRlRjQiOiPkQmRnRnRnRnRnRnj}؋̗à+8AI+yN8pSDfXP]]ZVdbQoeP|eOcNbN`M^L^JaLcMeNeNeNeNeNer߃ёƝ #1 <zC$qI2gN>^RHVXQPaWMlYKzXKWJUJTIRHQEUFWGZHZHZHZHZHZz؋˘)y4q<hB*^G5VM?OSGJ]JHiKGwJFȆIFȘHEɫFDEDCAG>J@M@M@M@M@M@MГĠyuo+ g4^: U@+NF4HN:EX8?8?8?8?8?֍Ȝ{qld# \+T1L7$E>+@F/=P1;[2:h1:w09/8.7,7+6*4+1.1/1/1/1/1/̘{phaZ R"K(D.=5"9=%6F&3P'2['0h&/w%.$-#,"+!+!* * * * * * ã{pe]V O HA;%5+22.9+B)L'W%d#t! |odYRKD = 71-)&&,"3;DO\k|     }pcXNG?8 2 -( $ $*1 ; EQ^mz pcWLB:3-( "    &.9D O Y f h h h h h *!$* ,1:FSao{,"#!(#)!/7DQ_lx !"###!!     -##$%'&&+#4"A!N!\!i u ! ! " # # $ % %&'(()(''!&"&"&"&"&"/$")!,"+',2*>)K (X (e"'r#'}#'#($)#*#*#+#,#,"-"."/!/!0 .".$-&-&-&-&-&-&0' .24#5.4:1G"0T#/a%/m'/y'/'0'1'1'2'3'3&4&5&6%6%7$6&5(5*4+6,6,6,6,6,2,59>!?+=6:B"8O&7\)6h+6t,6,7,8,9+:+:+;*<*<)=)>(>)=-2>2>2>2>242;AGI(G3D>!@J'>W-=c/=p0>{0>0?0@0A/B/B.C.D-E-E-D1C4B6B7C8E9E9E9E9E968BJQR&Q0N:IF&FR.D^3Dj5Dv5E5F4G4H3H3H4H4I4I5J5J8I;HJ>K>K>K>K>K>7>H S Z \$[-X7SA"OM,LY4Je8Kq9K{:K;L;L;MZK'VV3R`;Pk@PuBPCQCQCRDRDSDSDSETETFTHSITJUJVJVJVJVJVJ:G T `hkm&k0 i<eH!`S1Z\=WeDVoHVyJVKVKWKWKWLXLXLXLYMXNXOZOZO[O[O[O[O[O=L Z fmqs"s+s9nFiP.cY;_aF\jL[sP[|Q[R[R\S\S\S\S]S]T]U]U^U^T^T^T^T^T^T@P _j qvxz&z7 vDqN*lV9g^EcfN`nT`wW_X`Y`Y`YaYaZaZaZaZaZaYaYaXaXaXaXaXC Scn u z}"5 }BxL'sT6n\CjcNgjVes[d{^d_d_d_d_d`d`d`d`d_d^d]d\d\d\d\d\G Wgqx}ـЄDž2@~K$zS3uZAqaMmgWjn^hvbgdgdgegegegegegegcgbfaf`f`f`f`f`J Zjt{؁ӄˈ‰0?I!Q0|X>x_KseVok^lrej{hjijjjjjjjj}jj|ji|jg{if{id{ic{ic{ic{ic{icM ^mwӄΈƌ.=HP.W;}]HybTth^qnfnvk~mn|mozmoxmovmosmormmsmktlitlhukfukfukfukfukfPapzւψɌ,;FO+V9[EaQzf\vkfzsrmuqzqrpspqsnqskqsjqriqqjqokollnkmnimnimnimnimniSes}҅ˌĐ)9 DM(T6ZB_NdZz}idrynmlvvshuveuvduvbvu`vt_vsauqcsodrmeqleqleqleqleqlVhv؁ΉǏ &7 CK%R3X?]K}bWtfblkld}rs_|}v]|v\|u[}tZ}rY}qY{p[yo]wn^vm^vm^vm^vm^vmZlzԅʍ”"4@I!Q/V<[Gw`Sod^fih^poY{rWrWqVoUmTlSlUlV}lW|lW|lW|lW|lW|l_q~ωƒ0=FN+T7zYCr^NibY`gcYoiUzkTkSiSgRfQdOfPgQgRhRhRhRhRhduփˎ+8 BJ&|P2sU>kZIb_TZf\TnaRzcQbP`P^O\N[L]L_M`MaMaMaMaMaj{ЉƔ $3 >|E tL,lQ8cVC[[LTbTPlWNxXMWLULSKRJPHRFUHVIXIXIXIXIXq؂ˏ,|8t@lF&dK1[P;TVDN^IKhLIuLIJHIGGGFFDDFBIAKBMBMBMBMBMzъŖ|x#r0 k9c@[E(SK2MQ9HZ=Fe?Er>D=C;C:B9A7@9=<:>:@:@:@:@:@كʒ~rkg$a/ Z7R>KD'FL-BU0@a0?n/>}.>э-=џ+<ҵ*;):*7-504242424242ύ›uj_[U#N+H4B;=D :N"9Y"8f"8t!7 65541/ -"-"-"-"-"Ɨvk`WRLE# ?)91592B0L.X-e,t+*)((&%%%%%wk`UNH B< 61&--)5&>#G!S`p       xk_UKC=72 - ($ !'.6@KX h z         yl_TI@82,(#     % , 6 A N ] m}|m_SH>4-'!     ! * 5 AN[gqqqqq((*/ 7ES`ny                 '%',5BP ^ k w   $"#)2?M[ht! "#!$"0 <IWdp{  !!"##$%&&&%$$$####""()+!,,*8(E'R'_'l'w(()**+,,-../.--------$(/277(542@0M/[/g0s0}1233455677766 6"5#5$5$5$5$5$%.6<AB%?0<<8H7U 7b 8n!9y!9 : ; <<=>>>??!>%='=)<*<+<+<+<+<+(5= E K L#J,E7AC?P">]$?i%@t%A~$B$B%B%C%C&D&D&D'E'E)E,D.C0C1C1D1D1D1D1.; C NTU T) P2K>HK"FW'Fc*Gn,Gx-H-H.I.I.I/J/J/J0J0K1J3J5J6I7J7J7J7J7J73@ KV \^]%Z. V;SHOS)M]0Mh3Mr5M{5N6N6N7O7O7O7O8P8P8P:OS>T>T?T?T?T?U@UAUBUBUBUBUBUBUBUB< IWag ijk$j5 fBbM&]U3Z^;Xg@WpCWyDXEXEXEXFYFYFYFYGYGYHXHYGYGYGYGYGYG@ M\ekmn q!q3n@jJ#eS1a[;_cC]kH\tJ\|K\L\L]L]L]M\M\M\M\M\M\L\K\K\K\K\KC Q`inrsvw0u>qH mQ.iX:e`DcgJaoN`wQ`R`R`R`S`S`S_S_S_S_R_Q_O_O_O_O_OFUclrvx{|.{<wGtO+pV8l]ChdKekQdsUc{WcXcXcXcXcYbYbYbW~bV~bU~bS}bS}bS}bS}bSIYfovz|,:}EyN(vU5r[AnaKjgShnXfv[f]f]f^}f^{f^ye^we^we\weZweYwdWwdWwdWwdWwdWL\isz~Ā)8 DL%|S3xY>s_IpdRlkZ}jr_zi{axibvicticricpicnhcni`ni^oh\pgZpgZpgZpgZpgZO_lv}Ƃ'6 BK#R0}WGN)T5Y@x^KqcVi|h_ayof]wxjZwjYxiXxhWxgVyeUxdVvcWtbYraYr`Yr`Yr`Yr`YjẃÉ.; EL%R1{W=s\Gk`Rcf[[lcWvfUfTeScSaR`P`P~`Q{`Sx_Sx_Sx_Sx_Sx_^o|Ɇ*8 BJ!}P-uU8mZCe^M]dVWk\Su_Q_Q]P[OZOXMXKZLZM[M[M[M[M[ctρċ$3>~FwM(oR3gX=_\GXbORjTOuVNUNTMRLPLNJOHQGRITITITITITizʇ-}9 wBoH"hN-`S7XY@R_GNhKKtKJJJIIGIFHDGDEGCICJCKCKCKCKqҁō~{&u3n<gC`I%XN/RT7L\=Ie?Gq?F~?F=E>=@=@=@=@=@zˈtok*e5 ^<WCPI&JO-FW1Ca3Bm2A{1@0@/?->,>+;.917464646464҃đxlb ^Z*T3 N;HBCI!?R$=]$89A6K5V4b4p3ڀ2ۑ1ۥ1ܽ/-+)))))~qeZPFB=8#3+ /4->+H)T(a'p& % $ # " !      sg[PG=84/+ '' #0 9 C N \ l ~tg[PF<3/*& "! ( 1 ; GTdwvh[PE:1*%   '1=JYk}xj\PD9/&   %1>LZhxyyyy" & % ',5DQ^ k w "$#$)3AO\ i u  !!  % 1 > LYe q |             "-:HUan x               #$*!6CQ]iu~  ! ! " # # $ % % % % %%%$$$$$#'*..&,2)>'L'Y'e'p)z**+,,-.// / 0/./..----!)/ 6 : 9"7-390F0T0`1l3v34566677889887766666&0 7 @DD A( =49@8N9[:g;r<{<==>>????@@?!?#>$>%=%=%=%=%,6 @I MNK$F. C;AIAUBaBkCu C}!D!D!E"E"E"E#F#F#F$F&F(E*E*E+E+E+E+E+1 <GQUVTP(O7 LDIP I[%Ie'Io(Ix)J)J*J*K+K+K+K+L,L,L-K/K0K1K1K1K1K1K16 ANVZ[ YY$Y4 VARL!PV)O_-Oi0Or1Oz1O2P2P2P3P3Q3Q4Q4Q5Q6P7P7P6P6P6P6P6: ES[^_] a b1_>[IXR*U[1Td5Tl7Tu8T}9T9U:U:U:U:U;U;U;TKW^dfehi.g<cG_O)\W2Z`9YhXx?X@X@X@XAXAXAXAXBXBXAWAW@W?W?W?W?AO[cikkmo,m:jDgM&cU1a\:^c?]kC\sE\{F\F\F\G\G[G[G[H[G[F[EZDZDZDZDZDES^gmpprt)s8 qCmK$jS/fY9c`AagF`oI_wK_L_L_L_M^M~^M|^M{^Lz^Ky^Jy]Hy]Gy]Gy]Gy]GHVbkquuvy'x6 vAsJ!pQ-lW8i]AfdHdjLbrOb{Q}bR{bRybRwaRuaRsaRraQraOqaMr`Lr`Kr`Kr`Kr`KKYeouyy{ }$}4{?xHuO*rU5n[?kaH}hgNyfnSvewUteWreWpeWneWldWjdWidVidSidQjcOjcNjcNjcNjcNM\iry|~ !1=}F{N'wT3tY=}q^FwmdNrkjUnirYki|[ih\gi[eh[ch[ahZ`hYahWahTcfRcfQcfQcfQcfQO_mv|/; EL$}R0zW:yw\DrtaMkqgUfnn[bmw^_m_^m^\m^Zm]Ym\XmZXmXYlV[jU\jT\jT\jT\jTSdqz,9 BJ!P,{U7t}ZAlz_JewdS_ukZZst^Xs_Vs^Ut\Tt[StYRtXRsXRqVToUUnTUnTUnTUnTXhu~(6@H|N(vS3oX=g]F_bOY}iVU{rZR{~ZQ{YQ|WP|VO|TN|SMzSLySNvSNuSNuSNuSNuS\myƒ#2=~EwL$pQ.iV8a[AZ`JTgPPqSO}SNRMPMNLLKKIMHNHNI}NI}NI}NI}Nbs.~9 xBqIjO)cT3\YG>>?>?>?>?qˀ|v rn-h7 b?[FUL$OR,JY1Fb4Dm4Cy3C2B0A/@-@,>.<1:394949494yŇzkfc#^/Y8 R?MFGM!CT%@^'>i'>v&=%<$<";!: 8"6%4'3(3(3(3(̂sfYUR$N/I7 C??F;O9Y8d7r655431/.----Čwj^RGB@ <*844= 1F 0Q /] .j -y ,ъ +ќ *ҳ )( & $####zmaUJ@5/ -*#'-%8$C"O!\ k{|obWLA7-(% " )2=IV f y  qdWLA6-%   ! *5AO`tseXL@6,#   *7FXkugYL@4*!  ,<L^o~&#"$* 4 B P]iu%! !&2 ? M Zgr| "  #/ < I Wcoy  + 8 E S _ku~          (4A N [ gr{ICC_PROFILE        # & %# "/< I V b mw !"##$$%%&&'' ' ' &%%%%$ ' / 1 0 -* *7 'D 'Q (^ )i +s ,| --. . / / 0 0 1 1 2 1000////# + 2: <;7$30 0> 0L 2Y 4d 5n6w7788999::::99988888) 1;CE D@<);8 ;Fh>q?y?@@@@AAAAAA@@@ @ @ @ @ . 7BIKJ GF$F4 EADMDXDbEkEtF{FFGG G G G!G!H!G$G%F%F&E&E&E&E&3=HNPOK PQ0O=LHKS K\#Kf%Kn%Kv&K~'L'L'L(M(M(M)M)M)L+L+K,K+J+J+J+J+8BMSXYUXZ-X:UERO"QX'P`+Pi,Pq-Qy.Q.Q/Q/Q/Q0Q0P0P1P1P1O1O1O0O0O0O0<GQZ_`]_a*`8 ]CZL!XT)V\/Ud2Ul3Tt4T|5T5T6T6T6T7T7T7S7S7S6S6R5R5R5R5?KV_dfdeg'f5 d@aI^Q)[Y1Z`6Xg8Xo:Xw;X;WgGdO'aV1^\7]c<[k>[r@[{AZAZB}ZB{ZByZBwZCvYBuYAtY?tY>tY=tY=tY=tY=CR_hmpoo q!q1p<mEjM%gS/dZ7a`>_gB}^nDz^vFx^Gw^Gu^Gs]Gq]Ho]Hm\Gl]El]Cl\Bm\@m\@m\@m\@FUclqtssuv.u: rDoK"lQ-iW6~f]>ydcDubjHrarJpa{LnaLlaLjaLh`Lf`Ld`Ld`Id`Ge`Ee_De_De_De_DJZgouxxwz{,y8 wBuI rP*~oU4ylZ=si`DngfJjenNgewPedPcdPadP_dP]dO[dO\dL\dJ]cH^bG^bG^bG^bGM^ksx{||~)~6 |@zHwN'zuS1trX:mo]CgmcJbjjO_isR\i~SZiSYiRWiRViQTiPThNUhLVgJWfIWfIWfIWfIQbnw|&4>F|}L$u{Q.oxV7hv[@as`H\qgNWopRUo{SSoRRoQQpPPpNOpMNoLNnKNmJPkIPkIPkIPkIVgs{ !0; }CwJ pO*jT3c}Y<\{^DVxeKRwnNPwyOOwNNwLMxJLxIKxGJvGIuHItHJrGJrGJrGJrG\lw,}8 wAqGkM%dR.]W7W\?RcENmGLxHKFJEJCIAH@G@E}BD|BDzCDzCDzCDzCbr||'w4q=kDeJ ^P)XU1R[8Mb=Jl?Hw?H=G&>$=#: 9C6K4U3`2l1z10 / - - +)((((sfYMA7 53$0..8+A*L(W'd'r&Ȃ$Ȕ#Ȩ" vi\PE9/& %0<HUduۇܜܵ     yk^RG;1(  ) 5BP`s|n`TH<1' !,:I[npbUH<1'  "0@Sh}rdVI<0%  %6I^q$ ! & 2@N[gq{!    " /=KXdox   , :HUalu}      ) 6CQ]hrz     % 1?LYdnw     !,:GT_js{  ')&#'3AO[ f!p#x$$%&''(())**) ) ) ( ( ( (  $,23 0, (,&;)I+V-`.j/s0z11223 3 3 3 3 4 3 3222222%*4::7 20$254C 6P 7[ 8e 9m 9u:|::;;;<<<<;;;:::::*1<?@=8 =>0>> >J?U@_@hApAwA~BBBBBBBBBBAA@@@@/8AGJICGI,H9 GEFPFYFbGjGrGyGHHHHHHGG G!F!F!E!E!E!E!4>FOSSNPR(Q6 OAMKLTL]!Le"Lm#Lt$L|$L$L%L%L%L&L&L&K'K'K'J'J&J&J&J&6BMVZ[VWY%Y3 W>THRP!QX%Q`(Ph)Po*Pw+P+P,P,P,P-P-O-O-O-N-~N,~N+~N+~N+~N+9FS\`a^] _"_1^<[EXM!VU(U\,Tc/Tk0Sr1Sz1S2S2S2S3}S3{S3yR4xR3wR2vR1vQ0vQ/vQ/vQ/<KXaefdb ee.d: aC^K \R(ZY.X_2Wg5Wn6~Wv7|V8{V8yV8wV8uV9sV9qU9pU8oU6oU5oU4oU3oU3oU3@P]eikigij,i8 gAdIaO'_V/~]\4{[c8xZj;vZrlY>jY>hX>gXn]n@l]wAj]Bh]Bf]Bd\Bb\B`\B_\@_\>_[<`[;`[:`[:`[:FYelqsqprs&s3q=oE~lL"yjQ+tgW4oe\;jcb@fbjCcarEa`}F_`F]`F[`FY`EX`EW_CX_AX_?Y_=Y_=Y_=Y_=K]hpuvuuvx#x1v; tCzrJupO)omU1ikZ9ch_@_gfE[eoHYeyIWeIVeHTeGSeFQeEPdDQdBQc@Rc?Rc>Rc>Rc>Paltyzyy{ | }.{9 {zAvxHpvM%jtR.dqW7^o]>XmcDTklGRkvHPkHOkGNkEMkDLkBKkAKjAKi@Kh?Kh?Kh?Kh?Vfqx}~~~+|6w?q~Fk|K!ezP*_xU3Yv[:Sta@OsjCMstDLsCKsBJs@Is>Hs=Gs.=0;1;1;1;1ivuojg(c3^; XBSHNN IU%E])Bf*Ar*@~)@'?&>$="=!:$8&7(7(7(7(q}~pe_\Y,U5P= KDGKBR?[=d >E:M8V6`5l4y43210 .-,+++sgZNC><":,653>1G /P -[ ,f ,t+*('&$# " ! ! ! ymaTH;0*)'(%2#<"F Q]k{reXL@3) ' 3 @ M [k}БЦuh[NB6+"+9GWi}xj]PD7,!  "0ARf{|m^QD7,! &9LavoaSE8,   /DYm!   #0>LXdnx    .;IUaku}   *8EQ]hrz   &4ANYdnv}   "/<IU`jsz   )7DP\fov}   #0>KWajsz !!!! !!!$('#'7 F"R%]&f(n(v)}***++,,,,,,,, + + + + #-/-( &!*1-@/M0W2a2i3q4x4~4555 5 6 6 6 6 5 544333%+39;8036,7;8G 9R :[ ;d ;l >A(A6AB ALAVB^BfBnBuC|CCCCCCBBBAA@@@@+7DLONHGJ$J2I=HHHQGYGaGiGpGwG~GHHGGGGFFEEEEE/=KSVVPO R R/Q: ODMMLUL\Ld Kk!Kr"Kz"K"L#K#K#K$K$}J${J$zJ$yI#xI"xI"xI"xI"4DQY\\WUXY,W8 UASIQQ PX#P_%Of'On(Ov(O~)~O)|O)zO)xO*vN*tN*sN*rM)qM(pM'pM&pM&pM&8JV^aa][]^)]5 [?YGVN!UU&T[)}Sb,{Sj-yRq.xRz.vR/tR/rR/pR0nR0lQ0jQ/iQ.iQ,iP+iP*iP*iP*;O[bfeb`bc'b3a=^E\K }ZR&yXX,vW^/tVf1rVm3pVv4nU4lU4jU5hU5eU5cT5bT4bT2bT0bT/bS.bS.bS.AS_fjhfdfh$g1f; dC}aIx_O&t]U,p[[1lZb5jYi7gYr8eY{9cY9aY9_X9]X9[X9ZW8ZW6ZW4ZW2[W1[W1[W1FXcjmljijl!l.k8 ~iAygGteM$obS+j`X2f_^7b^f:_]n<]\x=[\=Y\=W\Uat?Sa?Ra>Qa=OaMg~>Lg=Kg;Jg:Ig8Hg7Gf7Ge6Gd5Gc5Gc5Gc5Veovwwwwy}zy|%u{1pz: kyAewG`uM"ZtR*UrW1Pp^6Lof9Jop:Io|9Ho8Go6Fo4Eo3Do1Cm2Bl2Ak2Aj2Aj2Aj2\jsz{{{|}~ws o-j7e>`~EZ}JU{P$PzU+Kx\0Hxe3Fwo3Ew{2Dx0Cx/Bx-Ax+@x*?v+=t,$=#=!;~#9}$8{&7z&7z&7z&iu|oga^![-W6R> NDIJDQAY>b =m KV`iqx~   +9FQ\emt{ %2@LWaiqw}   +9GR\ e m t{  "3AMXaip w }!"""###$$$$$$####((# !-%<'I)S*\+d,l,s-y-.../////...-,,,$.563+*.(072C3N4W5_5g6n6u6{777 7 7 7 7 7 6 6 5 5 4 4 4 +8?A?859#:2:>;I w\EsZKnXQ$kWW)hV^,eUe.cUm0aUw0_U1]U1[T1YT0WT0US0US.US,UR*VR(VR(VR(GWagfecbcef)|e4xd<sbCn`Ii^O#e\T)a[[.^Za1[Yj3YXs4WX~4UX4SX4RX3PX3NW2NW0NV.OV,OV+OV+OV+L[ejiihfhj}k&xj1si: ngAieGddM!_bR([`X.W_^2T^f5R]p6P]{6N]5M]4K]3J]2I]1H\0H[.HZ-IZ,IZ,IZ,Q_immllkm{oxp"sp.oo8 jm?elE`jKZhP%VfV,Qe\1Ndd4Kcn5Jcy5Ic3Hc2Fc1Ec/Dc-Cb-Ba-B`,B_+B_+B_+Wdmppppp{rut runu+iu5es= `rCZqIUoN!QmT(LlZ-Ikb0Gkl0Ekx0Dk.Ck-Bk+Ak)@k(?j(>h(=g(=f(=f(=f(\irtttt|uuwoyk{g{'c{1_z: Zy@UxFPvLKuR"GtX&Dsa)Bsk)Asv(@s'?s%>s$=s"|j!=|u <|;|:|9|8|7z5x4w3v3v3vit|||}~ti_Y VS&P0L8H? DF@M:8 6*431</D-M+W*b)n({'%$#! |qeYMC8-'&$'#1!; DOZftwk_SH<1& " , 7 B MZiy}qeYNB6* (3?KZj}xl`SF9-!  #/;IYlρϖέrdVH;/# &4DVlvgXK=/# ,=Rizj[M>1$ %7Lby+9GS^hpw} (6DP[dmtz   $2?LW`ipw}  -;GR\emsy'5BNXaiov{  /<HS\dlrx} (6CNX`hnuz  / = IS\ckqw} $$)7D N!X"_#g$m%t%z&&&'''''''&&%%%,22-% %$(2*?,J-S.[.b/i/p0v0}00000000///...*6<=82- 13-4:5E5N6V6]7d7k7r7x7 8 8 8 8 7 7 7 6 ~6 }5 }5 |4 |4 3?FEA<7:<)<5<@ {LFxKMuJSsJZqJaoJhnJplJyjJhIfIdI bH `H ^H^G^G]F]F]F=MWZYWTRS UV)~U3zS<vRCrPJoOPlNVjN]!hMd"fMl#dMu$bM$`M$^M$\L$ZL$XK$WK#WK!WJWJWJWJBQ[]\[YVXZ[&zZ1vY: qWAmUGiTMfSS!cRY$`Q`&^Qi(\Qr(ZP|(XP)VP(TP(SO(QO(PO&PN$PN"PM!PM PM GV_`__][]~^z`#v_/q^7 m]?h[EdYK`XP"\VV&YU])WUe+TTn,STy,QT,OT+MT+LT*JS)IS(IR&IR$JQ#JQ"JQ"LZcccba_~aycud qd,md5hb=daC__I[]N!V\T&SZZ*PZb,NYl-LYv-JY-IY,GY+FY)EY(CX'CW&CV%CV$DV#DV#Q^fffeedyfth pilj)hi3dh: _gAZeGVcLQbR#M`X(J``+H_i,F_t+E_*D_)B`'A_&@_$?_#>]#=\#=[#=["=["Wcjjiiizisknmiofo%co/^n8 Zm>UlDQjJLiPHhV$Eg^&Cgh'Ags&@g%?g$>g"=g of =orxS;x[9xe8xq7x}6x5x4w3w3v1t0s/q.q.qisuuuvywmyb}YQMK H*E3A;>B :I 7P5Y4c3o2|1 0 / . - +} *| )z)z)zpyzyz~zt|i]TJB>=":,754=2D0M.V -`,l+y*('&$#""! ! w~~~zodXND91 .,#+,)5'>%G$Q"[!g tui^SG=2(  *3=GR_l {  {ocXMA5+! &0;FSapvi]RF;/$#-8DRbt}pdXL@4( )5AQcwnjƣƽxk_SE7* $0>Pczߑߨ޿sdUG9,+;Nc{wgXJ;- "5Jax )7DPZdlsy   %4@LW`ipv|  !/<HS\elsy~*7CNXahouz %2>JT]dkqv|+9EOX`gmsx}%2?IS[biouz  +8DNW ^ e k q w ~ !  $2?IRZahntz )/,' -":$E%N&V&]'d'j(q(w)~))))))))((''')4962-%(+),5.@.I/R0Y0_0f1l1s1z112211}1{0y0x/w/w.w.!2>@>;7124$515;6E6M7T7[7b7h7o8v ~8~ }8 {8 z8 x7 v7 t7 r6 p6 o5 o5 n4 n4 ):EFEB>::< =-<7<@ _>_=_=8GPONMIGGIJ&}I1yH: uGArFHpFOnEVlE\jEchEkgEteE}cEaE_D]D[CYCXCXBXBXAXA=LSSRQNKMN}P$xO.tN7 pL?lKEiJLgJRdIYbI`aIg_Ip]Iz[IYHWHUHSGRFQFQFQEQEQEBQVVUTRPR|SxT!tT,pS5kR<gPCdOI`NO^MU[M\YMd WLm!ULw!TL!RL!PL!NK!LK KJ JJKIKIKHKHGUYYYXVT|VwXsYoY)kY3gW: bVA^TF[SLWRRTQY"RQa#PPj$NPt$LP$KP#IP#GP"FO!DO!DNDNDMELELLY\\\[Z}Yw[r] n^j_&f^0b]8 ^\?ZZDVYJRWPNVV"KV^$IUg%GUq%FU}$EU#CU"BU!@U ?U>T>S>R>Q>QR]____^x^q`lbhced#ad-]c6Yb< U`BP_HL]NI\T F\\"C[e#B[p#A[|"?\!>\=\<[:[9Z8X8W8W8WWbccbb}crckefgah^i[i*Xi3Th: Og@KeFGdLDcSAcZ?cd=cnkQ4*$"!%.7@JU`m{ }}||y}nbWLA7-#  # , 6 @KWesth\QF:0& !*4?LYhy{nbVK?3(  (3>K[l~uh\PD8-" $/;J\o}pcWK?2& *8I\r؉ס׷yl_RD5(  &4G\tteVG7)!1E\s &4ALW`hpv{ #0=IS]elsx},9DOYbiouz~ &4@KU]dkqv{!.;FOX`flrw| )5@JS[bhnsx~"/;ENV]djouz  '4?IQY`flrw~  . : DMU\bhnu{ ')%!(5?IQX^dk q x!!!!!!!~!|!{!z z z (220,' "$$0&;'E(M(T)Z)a*g*n*u+|+~+}+{+y*w*u*s)r)q(q(q("199851,),.,/7/@0H0P1V1]}1c|1j{2qy2yw2v2t2r2p1n1l1j0i/h/h.h.*:??><852 46(636<|6D{7Ly7Rw7Yv7_t7f s7m q7v o7~ m7 l7 j7 h7 f6 d6 b5 a5 a4 `4 `3 1ADDDA>;:;=$|=/x<8v<@ sS>R=R<R<R<>KLLLJGF~FzGvIrI)nH2jG: gFAdEGaEN_ET]D[[DcZDkXDuVDTDRDPCNCLBLALAL@L?L?COOOONLJyKuL qNmN'iN0eM8 aK>^JE[JKXIQVHXTH_RHhPHrOH}MHKGIGGGEFEFEEEDEDECHRRRRRPzNtPpQlShS$eS.aR6]Q< YPBUOHRNNPMUML\KLeILoHLzFLDLCLAK?K?J>I?I?H?HMUUUUU}TvRoUjVfXcX!`X+\X3XW: TU@PTFMSLJRRGQZEQbCQmAQx@Q?Q=Q KZDGYJDXPAXX?Xa=Wk1$  /AWnymaSD4%  ,@Vn #1=IT^flrx} -9FPZbiotz~ (6ALU]ekqv{#1<GPY`gmrw|+7BKT[bhmsx} %1<FNV]cinty+6@IQX_ejou{ $0;DLTZ`flqx~ *5?HOV\b h n u | ~}|| ""   $/:CKRY_ekry}{zxvutss(++)&"+6? G!O!U"["b~#h}#o{#wz#x$w$u#s#q#o#m#l"k"k!j!"1232.+'" $&'(2);~)D|*K{*Ry*Xx+^v+eu+ls+sr,|p,n,l+j+h+f*e*c)b)b(b(*799852/+-/#|0.y07w0?u1Gs1Nq1Tp1Zn2am2hk2pj2yh2f2d2b1`1^0\0[/[/Z.Z.2<=>=;863}4z6v6*r63p6<n6Cl7Jj7Ph7Wg7] e7e c7m b7v `7 ^7 \7 Z6 X6 V5 U5 T4 S3 S2 S2 9@ABA@=;|9x: t<p='m<0i<8g<@ eDEFEDA|@w?r@ oBkC$hB.dB5aA< ^@C \@IZ@PX@WV?^T?fS?pQ?zO?M?K?I>G=F=F<F;F:F:CGHIIH}FxDrDmFiGfH!cH+_G3\F: XE@ VEFSDMQDSOD[MCcKCmJCxHCFCDCBB@B?A?@?@??@>HKLLLLzJsGmIhKdLaM^M(ZM1WL7 SK> PJDMIJKHPHHXFH`DHjCHuAH?H>HMh=Ms;M:M8M7M5M4L3K3I3I3HPQRRRzRrRiQbT]UYW UXSX"PX+MW3IW9 FV? BUE?TLj:k8k6k'4k/1k6/k>-jE+jN*kW(ka'km%jz$j"j!i hhfdcb```auakbbcWfOiHk?n6p0r -s+s *s)(s1&s9$sA#sJ!sT s^sjsxrrqpomlkjddd{eqehf^hSlKnBq9t0v'y { {{!{*{2|;{D{N{Y{e{s { z yxwvt s siiiwinjdkYnOqEu|5+"!)2=IUcsts{sqtevYyN}C7-# )3>KYi{zyxyk{_SH<0&(3?N_qsfYMA5)$0>Oawzm`TG:."  !-=Pe{ˑȪuh[OB5)*<Ri~qdXL?1!&;Rk -;FQZbipuz*7BLV^flrw| &2=HQZahmsx} -9CLU\cinsx~'3=FOW]cinsy~ "-8AIQX^diotz'2<DLSY_djou|!,6?GNU[`flrx   &0:BJPW\bhov}~|zywvvv  +5 > F M SY_fl}t||zywusqpnmmm#%%#  &0:B~I|P{Vy\xbviuqsyrpnlkigeedd#*,-+)&"!} ,z!6x">v#Ft#Ls#Sq$Yp$_o$fm%nk%vj%h%f%d%b$`$^$]#\#\"\"+0221/-*&}%y'v))s)2q*:o*Bm+Ik+Oj+Uh,\g,ce,kd,tb,}`,^,\+Z+X+V*U*U)T(T(2577753}0z.v- s/o0%l0.j17h1>f1Ed1Lb1Ra1Y_1`^2h\2qZ2{X2V1T1R1P0O/N/M.M-M,79;;;:}7x6t4q4m5j6"f7+c63a6;_6B]6H[6OY6U X6\ V6d T6n S6x Q6 O6 M6 K5 I5 G4 G3 G2 G1 G1 ;=???>z<t:p9k:h;d<a<(^<1[<8X;>V;E T;K R;R Q;Y O:a M:k K;u I: H: F: C9 B9 @8 @7 @7 @6 @5 ?@BBB}Bv@p>k>f?b@_B\B&YB.VA5S@; P@B N?H L?OJ?VH?^F?hD?rB?~@?>>=>;>9= 9< 9; 9: :: BDEEFyErDlBfCaE]F ZGWG#TG+QG2NF9 KE? HDEEDLCDSAD\?De=DpEGHIIvInHgF`H[JWKTLQM OM)LL0HL6EK= BJC ?JJ=IQ;IY9Ic7In6I{4I3I 2I 0I /H .G -E -D -CIJKL|LsLkLbL[NVOQQNRKRIR&FR-CR4@Q:n5q-t$vy|~ $-6~@~K~W~d~s}}|zyxwvggvglhbhWkMoCr8v/y&{~  $,6BN\k|m}lslim]oRsGw<{1~'  #,7DRasrzrprduWxL|@4)  ",8GWi|xxxkz^~RE8-"  ,9J]q~reXL?2&(7J_wŽzm`SF9,  &7Lczߧݻui\OB5(#7Nf~+7BNW_fmsx} '3>IRZbhoty~"/:CMU]cioty)4>GPW^dioty $.9BJRX^diotz)3<ELSY^diou{ $-7?GNTY_djpv}(1:BIOU[`flrz~}|{zz  ",5=DKQW\bho~w|{ywvtsqppp  '09@G}M|S{Yy_xfwmuut~rpnmkih g f f    !~ +{4y<xCvJtPsVq]pcnkmsk|igfdb`_^^] #&&%#!}yv't0q9p@nGlMkSiZh`fhepcza_]\ZXWVUU&)+,+*({%x"v r o!#m"-j#5h$=g$Ce%Jd%Pb%W`&^_&e]&n\&xZ&X&V%T%R%P$O$N#N"N"+.010/z.u+r)o'l'i) f*)c*2a+9`+@^+G\,M[,TY,[X,bV,kT,uR,P,N,L+J+H*G)G(G(G'/2455|4v2q0m/i.f.c0`0&]1.[16Y1=W1CU1JT1PR1WP1_O1hM1rK1~I1G1E0C0A/@.@-@,@,36899x8r7m4h3d4`4 ]6Z6#X6+U63S69P6@N6FM6MK6TI6\ G6e F6p D6{ B6 @5 =5 ;4:4939291907:;<}<u<n;h9d8_9[: X;U< R<)O<0M;6J;=H;C F:J D:R B:Z @:c >:m <:y :: 8: 7: 59 39 38 37 36 35 ;=>?z@q@j?d>^=Z>U?R@PAMB&JA-GA4E@:B@A @?G =?O ;?W 9?` 8?k 6?w 4? 3? 1? 0> .>-= -; -: -: >@ABwCnCgC`BYBTDPELFJGHG#EG+BG1?F8 9EE 7EM 5EU 3E_ 2Ei 0Ev /E .E,E+D)D(B'A'@ '? ACEFtFkFcF\GSGNIJJFL CLAM ?M(V8X3Y 1Y/Y -Y(+Z/)Y7'Y>%YG#YO"ZY ZdYqYYXWVUTRRMNOtPiQ`QXRPSHVAX9[2]*_&`$a#a"!a+ a2a:aCaLaVaaan`|`_ ^ ] \ Z Y XQR|SpTeU]UUVLXC[<^4`,c$eh hhh$i,i5i=iG hQ h]higwgffdca`_VWwXkXbYZYQ[H]>a6d.f&iln q qqq&p.p7pApKpWpcoronnmkihg[\r\g]_]V^LaCd8g0j'mpr uxxxyy'y/y9yDyPy]ykx{wwvtsrq`zanada[bQeGhL[l|lrkhk\nPrDv9z-~"  %1?O`tyqpqctVxJ|=1% %2CUiwwjz]~QD6* $3G\rreXK>0$  1G]wאצֺmaTG8+2Iby (4?IS[ciouz $/:DNV]djpuz*5?HQX^djouz %0:CKRY_djot{!*4=ELSY^diou{%.8@GMSY^diov}  )2:BHNTY_djqx$-5=DJOUZ`fmt}~|{yxwvvvu (18?FK~Q|W{\zbxiwqvytsqonmlkjj   "~,|4z;xBwHuMtSrYq_pfnnmwkihfdcaa``}zw't/r7q>o Dn Jl Pk Wi ]h ef md vc a _ ] [ Y X W W W  }ywv sp"m+k3i:gAfGdNcTa[`b^k\tZYWUSQPOOO#$%&|%w#s pnlif'd0b7`>^D]K[QZXX`W hU rS }Q OMKIHHGG$()*+x+r)m&j$h!e!b"_#$]$,[%4Y%;X%AV%HT&NS&UQ&]P&fN&oL&zJ&H&F%D%B$A$@#@"@"(,-/|/t/m.i,e*b(_( \)Y*!W+)U+1S+7Q+>O+DN,KL,RJ,ZH,cG,mE,xC,A+>+<*:*9)9(9'9',013y3p2j2d0`.].Y.V/S0Q0&O1-L14J1;I1AG1HE1OC1WA1`?1j=1v;191705/3/2.2-2,3,0356v6m6f6`5\2W3S4P5N6K6#I6+F61D68B6>@6E>6M<6U:6^86h66t462515/4-4,3,2,1-0468}9r:j:b9\9W6R8N9K: H;F< C<(A;/>;5<;<:;C8;J5;S4;\2;f0;r.;-;+:):(9&8&7&6&579;z<o=f=_=Y=R<M>I?E@BA@A=A%;A,8A36A93A@1AH0AP.AZ,Ae+Aq)A~'A&@$@"?!> < ; :;=?w?l@c@\AUAMAGCCE?F;G9G7G"4G)2G00G7.G>,GF*GO(GX'Gc%Go#G}"G FFEDBA@>@BsCiC`DXDQEIFBH=J8L4M 1M/N-N&+N-)N4'N<%ND#NM"NV NaNnN{MMLKJIGFBD|EpFeG\GUHNIEK?M8O2Q,S(T&T$T"#T)!U1U9UAUJUTU_TkTyTSR Q P O NMFHxIlJaKYKQKKLBO:R4T-V%Y[ [[[$\,\4\=\F\P [[ [g [uZZYXVUTSKLsMgN^NVOOOGQ>T6W/Y'\^ac c c c&c.c7c@cKbVbbbpaa`_^\[ZO|QoRcRZRSSKTBW9Z0](_ begjkkk k(k1k:jEjPj\jjizihgfecbTvVjV`VXVOWFZ<]3`*d!filoqr rss!t)t2t=tIsVsdstrqqpnmlZq[f[][U[J^@a6e,h"lortwyzz {|}"~*4~A~N~\~m}|{{yxwy_m`c`Z`ObDf9j/n$rux{} "*7ETdwteieaeUhIk=p2t'x|  +:J[mpkhj[mOqBv6{* *;M`vopbsUwI|;.! -@Tkjy]~PC4( ,C\tыҢѶeXK=0" -D]w$0;ENW^dkpv{ +6@IQY_ekpv{&1;DLSY_ejpu{ !+5>FMSY_djou|&/8@HNTY^diov~ !*3;BINTY^djpx%.6=DJOTY_eks{~}||{{{  )18?EJPU~Z}`|gznywxvusrqpppp$,~3|:zAyFwLvQtWs]rcpkosm}ljigffeed ~ |yw'u/s6q<pBnHmNkSjYh`ghfqd{ca_^\\[ZZ |x wusp"m*k2i9h?fEeKcQbW`^_f]o\yZXVTSRQQQztqon li f &d .b 5a ;_ B^H\N[UY\WeVnTyRPNLJIIHH!|!t njhfe b_"]*[1Y8X?VEUKSRQZPbNlLwJHFDBAAAA!#%x&p%i$e"b_^ [XV'T.R5Q<OBN IL PK WI `G jE uC A ? =;9999"%'~)t*l*e)`']%Z#W"U"R#P$$N%+L%2J%9I&?G&FF&MD&UB&^@&g>&s<&9&7&5%3$2$2#2"2!&)+{,q-h.a-\,X*U(Q(O) L*J*!H+(F+/D+5B+<@+C?,J=,R;,[9,e7,p4,}2+1+/*-*+)+(,',&),.x0n0e1^1X0T/P-L.I/ F/D0B0%@1,=13;1991@81H61P41Y21c01o.1{,1*0(0'/%.%-%,&+-/2u3k4b4[4T4O3K2G4C4@5>6<6"96)76056636>16E/6N.6W,6a*6m(6z&6$6#5!5 431003~5r6g7_7W7Q7K7E8A9=::; 7<5< 3<'1<-/<4-<;+<;7:x<k=a=X>Q>J?D@;B6D1E-G)H'H%H #I'!I/ I6I>IGIQI\IhIuHGG F E D B A;>t?h@]AUAMBGB@D8F3H-J&L!N OOO#O+O2O;ODONOY Oe OrNNMLKJIH@}BpCdDZEQEJEDF=H4K.M(O!QTV VV V& V. V6V?VIVTU`UmU|TSRQPOODyFkG`HVHNHHIAJ8M0P)R"TWZ ]]]]!])]1]:]D]O][\i\x[[ZYXVUIsKfL\LSLLLDMeIeUecdrccba`_^|NnPbPXPQPIQ?S6V-Z$]`c ehjk llmn$o-o7nBnOn]nmm~lkkjigvTiU^UVTNUDW9[0^&beh knpstu vwxy%z.z:yGyVyexwwvuusspYdZ\YSYI\=_2c(hko ruwz|}%/=M]ok_b^Y^NaBe6i+nrv z} $2CTf{hd`dTgHk;p.u"z~  $5I[ogjZmNqAv4|&  %8LazbsUwH}:- )>Un͆͝ͳ]~PB4& (@\w ,7AJRY`fkqv|'2<EMTZ`fkqv} ",6?GNTZ`ekpw}'1:BIOUZ_ejpw #+4<CJOUZ_djqy&/7>DJOTZ_eks{!*19?EKPUZ`fn}v|{zyxwvvvv %,4:~@}F{KzPxVw[ubtirqp{pomlkjjjj |z y(w/v5t<rAqGoLnQmWk^iegmfwedba`____|zvtro#n*l1j7i=gCfHdNcTaZ`b^j]t[ZXWUUUUT x t pol jhf&d-b3`9_?^E\K[QYXX_VhUrS~QOMLLKJJ yrlif fda_!])[/Y6X<VBUHSORVP ^N gM qK }I G EDBAAA~tlfb_^] [ X V%T,S3Q9O?NFLMKTI\GfEqC}A?=;9999z p!g!a \YWVTQO!M)L/J6H<GCEJDRBZ@d>o;{97531122"w$l%d%]$X#T!RPM KIG&E,C3B 9@ @? H=!O;!X9!b7!m4!y2!0 . ,**++"%s'i(`(Y(T'P&M#J"G#E#C$A%#?%*=%0;&69&=8&E6&M4&V2&`0&k.&x,&*&'%%$$$$#$"%!"&|(p*e+],V+P+L*H(E(A)?)<*:+ 8+'6+-4+42+;1+B/,K-,T+,^),i',v%,#+!+*))('&)y+m-b.Z/R/M.H.C-?.;/8/ 604021$01+.11,18*1@)1I'1R%1\#1h!1u110//.-,)-v/j0_1V2O2I2D2?2945425/6-6,7!*7((7/&76$7>"7F!7P7Z7f7s76654321-0s2g3\4S5L5F5@6:739/:,;(< &<$=#=%!=,=3=;=D=N=X=d=q=< ; ; : 9 8 71}4o5c7Y7P8I8C9=96;0=+>&@!B BCC!C)C0D8DACKCV Ca Cn C}BA@?>=<5y8l9`:U;M;F<@<:=3?-A'C!EGI JJJ% J, J4 J=JGIRI]IjIyHGFEDCC:u<g=\>R>J?C?=?7A/C(F"HJM OPPQ!P(P0P9PBPMPYPfOuONMLKJI>p@cAXBOBGBAB:C2F+H#KMPRUW WXX#X+W3W=WHWTWaWpVVUSRQQzCkE^FTFLFEE>F5I-L%OQTVY\] ^^_`%`.`7`B_O_\_k^|^]\ZZYtHfJZJQJJIBJ9M0P'SVY[^acde fgh i'i1i<iIiWhfhwgfedcbmNaNWNONGN=Q3T*W [^ bdgjlmop qrt u(u3u@tOt^sprqpoonhS]STSMRBU6Y,]!ae iloqtvwyz| } *7FWh}~|{{{cYZXSXGZ;_/c$hl ptwz} *:L_s`^Y]M`@e3j'otx} -ATi`cSfFk9p,v|1G[qZlMq@w2}$!6Md~ʗȰUwG}:+&?Yr(3=FMT[aflrx~ #-8AIPV\aflrx(2<DKQV\aflry$-6>EKQV[afls{ (08@FLQV[agmu}"+3:@FKPV[agow~}}}| %-4:AFKP~V}\{bzjxrv|trsrqpppp~ }(|/z6x;wAuFtKrQqWp]ndlmjwhgfeedccd~zw usr#p*o0m6l<jAiGhLfReXc`ai`r^}\\ZYXXXYytqnljhf%e,d2b7`=_B]H\N[UY\WeVnTySRPONNNN x pkhfd b`^!\([.Y4X9V?UETKRQQYObMlLwJIGFEEEE {qid` ^][ YWU$S*R0P6O<NBLHKOIWG`EjDvB@>=<<;; vld^ZWU T SQN M'K-J 3H 9G ?E FC NB V@ _> j< v9 7 5 4 311 1~rh_YTQONM KHF#E*C0A6@=>D<L:T8^6i4u2/-+)))*{nd [ UPLIHFDB@ >'<-:48:7B5J3R1\/g-t+(&$"""#w k"`#X#Q#L"H!D C@= ;97$5*3 12 80 ?/!H-!P+!Z)!e&!r$!"  t#h%]&T&N&H&D%@$=#9#7$4$2%1%!/%(-&.+&5*&=(&E&&N$&X"&d &p&&%$$#""#q&e(Z)Q)K)E)@);)7(4)1*.*,+*+)+%',,%,3#,;!,C ,L,W,b,o,}++*)(('#|&n)b+W,N,G,B,<-7-2-./+/(0 %1#1"1" 2)20282A2J2U2`2m2| 1 0 //. - ,'y)k,^.T/K/D0>09040.2)4$5!67777&8-858>8H8R 8^ 7j7x7654322*u-h/[1Q2H2A3;36314*6%7 9;= =>>#>* >2 >:>D=N=Z=f=u=<;:987/q1d3X4M5E6>69636.7':!<>@C DDDD&D.D6D@DJCVCcCqCBA@?>=|3m5_7T8J9B9<9690:*<">ACE HJ JKK"K*K2K;JFJRJ_JmJ~IHFEDDw8h:[;P<G<@<:<3=,?%ADFI KNO PQRS%S-R6RARMQ[QiQzQQOMLKq=c?V@L@D@>?7@/B'EHKM ORUVW XZ[ [([1[<ZHZVZeYvYYWUTSkB^CRDIDCC;C2F*I!LOR UWZ\^_` bcd"e+d5dAdOc_cpbba_^]eHYHOHHG@G6J-M#QTXZ]`ceghjk mnp#p.p:oHoXnjm}lkjih_MUMMLFL;O0S&VZ^behknprtuwy z|~$~0~>}O|a|u{xwvu[SSRLQ@T4X)]afjnqtwz|~ &4EXmYWRVFZ9^,cinsw{~%8LaxX]L`?e1j$pv{ *@VmRfFk8q*x~ -E\tˎɧMq?x1~# 7Oi $/9CKRX^chnsz  *4>FMSY^cinu{&/8@HNTY_dipv~  *3;BHNSX]cipx$-4;BHMSX]cjr{ '/6<AGLQW]ckt~}{ywxxxvu!)06;~@|E{KyQwVv]tdrmqwomljkjjjj}{ yxw#u*s0q6p;o@mElKkQiXg_fhdrb~`_^^^]]]{vrpmkji%h+f1e7c<bAaF_M^S\Z[cYmWyVTTSRRQQxqlifc a`_!^'\-[2Y7X=WBUHTORVQ_OiMuLJJIHHGHyphc_][Y WVU#S)R.Q4O9N>MEKLJSH\FfDqB~BA@?>>> s i a [ WUTR POML%J+I0H6F;EBCIBP@Y>c;o:|9865555 {nd\VQN L LJ IGE!C'B-@3?9=@<G:O8X6b4n2{1/-,,,, vj_WQLHFED C A ? = $; *: 18 76 >5 F3 N1 X. c, o* }( % $ # ! sf\SMGC@?>< :86!4(3.15/<.D,M*W'a%n#| }obXPID?;97531/.%,+*2(:'B%K#U!`lzzl_ U!M!F!@!;!7 42/- +)' "% ($ 0"!7 !@!I!S!^!k!y      wi!\#R$I$B$<$7$3#0#,#)$&$$%"% &&&&-&5&=&G&Q&\&i&w & %$##"!t!f$Y%O&F'?'9'4'0',''(#) *+ +,,#,*,2-;,D,O ,Z ,f,s,+*)('' q%b'V(L)C*<*6*1*-*)*"-./0 122 2' 2/ 372@2K2V1b1p10/.--,}$m(_*S,I,@-9-4-/-+-&.0246 8 888$8+838=8G7R7_7m7}754322x(i+[.O/E0=07010-/(0"2468 ;= >>>!>(>0?9>C>O=\=j=z=<:988t-e/W2L3B3:34302*3$579< >@B CDEF$F+F4F>EKDXDfDwDCB@?>o2`4S5H6?68635-6&8:=? BDGHJ KLNN'N0N:MFLSLcKsKKKHFEi7[9N:D:=:7909(; >AC FIKNOQ RTVW"W+W5V@UNU^ToTSSQPMc<U=J>B>;=4=,?#BEH KNQSVWY[ ]_`a%a/`:`H_X^j^}]\\YX]BQBGB@A9A/C&GJN QTWZ\_abdf hjlm(l4kAjQjdiwhgffcWGMGFF?E4H)LPT X[^aegjlmoqsu wzz+y8xHw[voutrqpSLLKEJ9M-R"V[ _dgknqtvxz|~  .>Pe{RQKP>S2X%^b hlquy| "2E[rQVEY7^*djpv{"7Ne~K`>e0k"ry~)BZrNJ¥Ek7r)y .G`y !,6@HOV\bgmsy(1;CKQW\aglsz ",5=DKQV\agmt}&/7>DJOUZ`fmt~  (07=CHLRX^emv}{z"*17=BFKPV^}f{ozzxvtrICC_PROFILE qqqon ~}$}+{1y7x<vAuFsKrPpWn_miksigedccdcczvsqpon%m,k1i7h<gAfFdLcRbY`d^n\yZXWVWWXWzsnjge dbb a'_,^2]7[<ZAYGXMVTU^SiQtOMLKLLMLypic`][YXWW"U(T-S3R8Q=OCNIMPKZIdGpE}CABBBBB}rh`ZWTRQ ONNM$K)J/I4G9F?EECMAV?`=l;y9799888wkaYSOLKIH GFE C%A+@0?6=<<B:J8S6]4i2v110////r f \ T M I E CBA @>=;":'8-73594@2H0Q.[-g+u*('&%&&| naWOIC@= ; :: 8643$1*00.7->+G)P'[%f#t! yj^SKD?:7543 2 0 . - "+ () /(6&>$G"Q\hv     ugZPHA;630.-+*(&$%",!4<EOZft     rcWMD=73/,)'%# !"*1:CMXe r o`TJA:40,(%!    !'!/!7!A !K !U!a!n!} {k]Q G!>"7"1"-!)!%!!!"$$&&& '$ '+ '4'=&G&R&^&l&{&$#"! xhZ!N#D$;%4%/$*$&$"$$&(* + ,,,!,(,0-9,C,N+[+i+x++('&%td#V%K&A'8(1','(&$& &(*, .1 1222%2-353?2K1X1f1v00.-++p#`&R(G*=*5*/**)&)")*,/ 135 6789"9)929;9G8T7c7s766421k'\*N,C-:.3--,)+$,-/2 469;< >?@@%@.A8AC?Q>`=p===;98f+W/J0@17110,/&/135 8:=?AC DFHI!I*I3I>HLG[EmEEDDA?`1R3F4=45402*2"479 <?BDGIJL NPRS%S.S9RFQVOhN{NMMLIZ6M8B8:846.6%8;> ADGJMORTVX Z]_^(^3]@[PZbYwXWWVUT<I<?<9;2:(=@D GKNQTVY[]_bd gik"j-i:hIf[epdcbaaOAEA>@8?-B"EJ NQUX[^adfhkmor uwx%w2uAtTsiqpommKFDE>D2G&KPUZ]adgknqsuwy|~(7I^v~|{JJDI7M+RW\afjorvy|+>RjJO=S0X#_djpvz1F^wDY6_)el sz 8RjÃÜ=e/l!s{*G_w*4=EMTZ`ekqx $.8@GMSY^djpx)19@FKPUZahpx"*29@EJOTY_foz~}$,39?DINSY_gp~}{xtsr %,39>C~H}M{SzYx`wiutspnlkjggf|zxwww&u-s3r8q=pBoHmMlTj[icgme{b`^\\[\[}wqnkj iii!h(g.e3c8b=aB_H^N\U[^ZgXsVTQOOOQQ{rjea_^]]\\"Z(X-W2V8T=SCRIPPOYMbLnJHFDCFGG~rg`ZWUSR RQPO#N(L-K3I8H>GEELDTB^Ai?z=:98<<=vj_WRNLJIH GFFD$B)A.?4>:<A;H9P8Z6f4u2101233~pcYQKGDB@? >=<; 9%8*6/563=2D0M/W-d+q*)())))yj^TKE@<:876 5431!/&.,-2+:*A(J'T%a#o"~! tfY O G @ : 6 3 100. -+*($')&0$7#?!H S_m|p b VKC<62., * ) ) '%$"!!' .6>H R^l{   } m ^RH?82.*'%#"! &.6?IT ` l {    z i[OE<5/*&#!$+4 = F P\ixwfXLB92,'#   ! (/8BMYfvscUI>6/)%!    !$!,!5!>!I V d to_QF;3,'" "$%%&&"&)&2';'F&T%b%r$$$!k[NB!8"0"*!$!!  " $&(* +,,,&,/-8-C-O+_*p*))(&$gW!J#?%5%-$'$## ""#% ')+-/ 1333#4+454@4L2\1m00//,*b"S%F';(2(+'&&"%$&' *,/2468 :;;;';1<<==;W,J.>/4/--)+#+-/258;=@BEGI KNNN(N3N?NMK`IuGGFEEQ1E2:322-0'/147:>ACFIKNPRU WZZ"Z-Y:YHXYUoRRQPPL6@78624+3!69=@DGJMPSVXZ]`b fhh&h2gAeQbh`^]\[G;=;7908%;?CGKOSVY\_bdgilor vwv+u:sJp`nxlkihC@=?6=+@EJOSX\_beilnqsvy| "1BWo|{ywCDUoiDhJfQdXbaak_w^][YVSRRunigfedddc#a(_-]3\8Z=YCWIVRT[ReQqPOMKIGGGsia][YWW VVVT"R(P,N1L7J<ICHJGTF`DkCzB@?=<<?vi_WSOMLKJ IHFD"C'A,@2>8=>;E:N8Z7f7t6432226}naWPJFCA@>< <<:8#7(6-433:2A0J/V.b,p+*)))+-vh[QIB=:7543 3310.$-),0+6)>(F'R%^$l#~!!!!"$qbVLC<73/-,,+ +*(' &&$,#3";!CO[iz|l^QG>71-)'&%$# #! #)08AMYgwxhZM C : 3 - ( % "   &.6@KWd t ueV J ?6/)%!         $ , 5 ? J V c s qa S G<3,&"    #*3=HTaq n ] PD90)#    '/:EQ_o j ZM@6-&!  $-6BN\mfWI=3+$     "!*!3!? L ZlbSF:0("  "% &&''''1';'I'W&h#}#"!!^OB6-%  !#&(+ --..$...8.F.T-d*z(('''YK>"3"*"#!  "%'),/14 666!6*656B6P6`2w0/...T!F$9&/%($"#!!" $&),.1369; >???'?1?>?L?\=p96655O&A(5)-)&'"%$&(+-1369<?ADG JJK!J,J9JGIWHjC@@?>I+<-2-++&) (*,037:=@CFIKNQT WWV&V3VAUQTdOLJIHC18200*.$-/2 6:>ADHKNQSVY\_b ee d,d;cKa]]xYVVU?65503)148 <AEIMPSWZ]_begknrtt&s4sCqUmoifed;:58/7#:? DHMRVZ^aehknqtwz~*;N}fzwut;>5<)@E KRV[`dhkosvy| 1D\v;B/F!LRY_ejoswz~$8Oi5M(SY agntz(@Zv.Y ahpw0Lg  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D6KHS]Zs`ehjlmʽrݽx誱( 2<&D6KGR]Ys^bcehkѺoڭs䛴zzzzzzzzzzzzzzzzz( 2<%D5JGQ\Ws\^`cfŹiήlסpu鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u( 2<%C4JFP[VrY\_bd¯gˤjӗm܈q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q( 2;%C3IEOZTrV[^aceǛhϏjׂnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނn( 2;$C2ICNYQqTZ]_acÓeˇg}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l( 2;#C0IAMWOpSX\^`abƁexjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxj(2;!C.H?JVMoRWZ\^_`{bshshshshshshshshshshshshshshshshsh(2;B+H;IVLnPUY[\\~^u`nenenenenenenenenenenenenenenenene(2;B&DVAb~EluIsmLxhN|cP`S]VZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZY$/1&346A:N{=Yr@ajDhdGl`Jo]MqZOsXRtVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVu % )*#,/1;{5Fq9Ph=Xa@^\DbYGeWJgUMiSQjRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTk% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /9$B2JAST\hd|ltz䣀ޜږՎҊ޷zvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫv% /9$B1JART[hc|jqv|ݥ؟Җ͏}{{{{{{{{{{{{{{{% /9$B1I@QSZha}hnrwۮ{֩ѣ馇ꛂ囂囂囂囂囂囂囂囂囂囂囂囂囂囂% /9#A0I?PSXh_}ejnqںuչ}ȯಟꞒ쒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉% /9#A/H?PRWh^}cgilrx־ߨ阢틓ꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓ% /9#A.H>OQVg\}`ceinͼrְxޞ~蔵뇢臢臢臢臢臢臢臢臢臢臢臢臢臢臢% /9"A.H=NQUgZ}^_bfºi̯mբqޑv牸煳关关关关关关关关关关关关关关% /9!A-G2@EBWEfIsN~|QtSlTgVbY^]\bZgZgZgZgZgZgZgZgZgZgZgZgZgZgZg#(* 6:1;A>QB_Ej|ItsM{kOfRaT^W[[Y_XcXcXcXcXcXcXcXcXcXcXcXcXcXcXc,24.7<:J=VzAaqDiiHocKs_Nv\QxZTyXW{V[{U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_| ),.*175Cx9MnVTAYQD[PG\NK]MN^LQ_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@.I*F8MIV]]qdkpu۰|ל״ݮߜߓڒגגגגגגגגגגגג" ,6 >)F7MHU\\qbhlrԷyǭκ֬ޢ┋ዃ܋ڋڋڋڋڋڋڋڋڋڋڋڋ" ,6>(F6LGT\[qaejpͽv|ͳդݖ㍓ㄉ߄܄܄܄܄܄܄܄܄܄܄܄܄" ,6>(E6LGS[Yp^bgmsùx̬}՝݌㇟~~~~~~~~~~~~~~" ,5>'E5KFRZXp\`ejp²u̥yԕ}܇ᅮ{zzzzzzzzzzzzz" ,5=&E3KDQYVoY]bgkp˝tӍxڃށyxxxxxxxxxxxxx",5=$D2JCOWTnV[_cfiʐl҃p|}yvuuuuuuuuuuuuu"+5=#D0JANUPlTZ]_abȂcwhsuq‡oÜqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤ"+5= D-I=KSNkRX[]__{aqemqkƀjǒiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗ"+4<C)G9JSMjP~VY[\~]t_ldhmgzf̉e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎!+4<B"D:HRKhNzSWYZv[m]gbdjbua҂a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆!+ 3;="C;FQHdKuQTVxWoYh[c`_f^p]{\\\\\\\\\\\\\!* 2 1<%A;BNE_HnM{QzSpUiWcZ_^\c[kYtYwYwYwYwYwYwYwYwYwYwYwYwYw ')2:&=9?JAYEgIrzM{qPiRcU_X\\Z`XgWnWqWqWqWqWqWqWqWqWqWqWqWqWq#15&86:D=RA^yDhpHphLvbOz^R}[U~YYW]VbThTjTjTjTjTjTjTjTjTjTjTjTjTj  & -/$225>8JwWWA[TE]QI_PL`OOaNRaMVaLZbK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\b !$(t)2i-;`1BY5GT8KPQPXd_xekظr̰x~³̨ԟ؜؏؉Ԉψψψψψψψψψψψ (2;"B.I=POWd]xciӾpƵv{­ˡӕِڈځցссссссссссс(2:!B-Is6Hj:Pb=W[A\WE`TIbRMdPQeOUeNYfM]fLcfLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeظ  "%$}).r,8h1@_4GY8LTVM`^jnt~}󁆙zvttsplffhêhêhêhêhêhêhêhêhêhêhê %09%B/J=UL_]hnr~{򉃜퀋zvvupifilllllllllll %/9$B.J;TK]\gnpxꇈ~xuvrmjmooooooooooo %/8#A-I:RJ[\ennv~㌄ۀyxzxºr¯mprrrrrrrrrrr %/8"A,H9PIZ[bmkt{ܑ҇~|}ſ}ųwĨqĤsuuuuuuuuuuu %/8!@+H8OHXZamiqw֙~̎…»ǸǷǬ|ǡvǝwxxxxxxxxxxx %/8 @*G7OGWY_mgnۧuО|ƕ²ȮʭʥʚzɖyÔzzzzzzzzzzz %/8@)G6NFVX]ldk֭sˤyɥ̣̝̒~̎|Ǝ}}}}}}}}}}} %/7?'G5METW\kbܹiѱqũw|ɛΘϕϊ·ɇÇÇÇÇÇÇÇÇÇÇ %/7?&F4LCSVZj`~ؿg˶ntz~ɒύыт~%.7?%F2LBRTXi^}eƼlqv{ȉЂӀ{vxxxxxxxxxxx%.7>#E0K@PRVg\|cinsw{ǁzyvqqqqqqqqqqqq%.6>!E.J=NOSfYz`fjosvz|utrmmmmmmmmmmmm%.6=D*I9LLQdWy]bfjm~qsxponjjjjjjjjjjjj%-5=C&H4KJObTwY]adfukmukDŽjʖjͫffffffffffff%-5<BE3JJMaQtUXZ\v^jceod}cьbѝaҲaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻ$ , 4 :<D4HJJ_MqRUWzXmZd``j_v^փ]ג\ؤ[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش$+12 < B5EIG\JlNzR~UrVhYa_]g[qZ|YވXޘXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥ"''2;"?5BGDWGfKsO~uRkTcX]]ZdYmXvW倘V捗V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖  28#;4>C@RC_FkvKtmO|eR_VZ[XaVhUpTyTSSSSSSSSSSS  %/3#619?BA=EA*G6QD[TeenuwztponmiefëiǤkˠkˠkˠkˠkˠkˠkˠkˠkˠkˠ ",5 >)G5PCZScdluu}uppqsnjjlŨnȣnȣnȣnȣnȣnȣnȣnȣnȣnȣ ",5>'F3OAXRbcktsz݄yttuwtomp¬qƧqƧqƧqƧqƧqƧqƧqƧqƧqƧ ",5>&E2M@VP_bitqߔw֋~́zxyzytqstêtêtêtêtêtêtêtêtêtê "+4=$E0L>UO]bftnٛuВ|ƈ||~xtvwwwwwwwwww "+4=#D/K=SN\`dsݨkԡsʙz}xyyyyyyyyyyy "+4<"D-KC"G:LRRgWy\`cfrjisffeãdŸbbbbbbbbbbb ! ( 0 6 ;@#G:JOOdSvWZ\u_idcoaaҐ`Ԣ_ַ]]ê]ê]ê]ê]ê]ê]ê]ê]ê]ê !'-16@%E;HNKaOrRUxVkYa_]j[yZ܇YݖYݦW޻XɢXɢXɢXɢXɢXɢXɢXɢXɢXɢ #%$7>'B:ELG]KlOy|RpTfX^^ZgYsXW䌛V䚚U嫙T庘T庘T庘T庘T庘T庘T庘T庘T庘T庘 )6;(>9AIDXGe~KqsN{iRaV[\XdVnUyU샌T쏋T퟊SSSSSSSSSS + 37(:7=D@Q}B]sFgjJobOv\TzXZ}Ua~Si~Rq~R{}Q|Q{PzPzPzPzPzPzPzPzPzPz ֿ) .2&538?{;Jq>ThA]`EcZJhVPkSVmQ\nPcoOjnNqnNzmMlMlMlMlMlMlMlMlMlMlMlֶ$(+#//z29o5Bf8J^MICOGHPFMPDQQCVQB[QBaPAiPAoOAoOAoOAoOAoOAoOAoOAoOAoOAoOθ  wl %a$-Y'3R,8M0HD=KD97A96D95H94L93P93P93P93P93P93P93P93P93P93P9} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt~ zs!l-!s5&w>/yH9xSEs`Rmm^hzhendqdsdtdueuevfwdwbx`x^y[zZyZyZyZyZyZyZyZyZy { u!p,x4$}>-G7QDz^Qtj_nvjisgxf{f|g}g~ggeԀcׁ`ڂ]݃\]~]~]~]~]~]~]~]~]~ | v!t*}4#=+F6PB\P{g^urko~vj}ihhhhhˈfщcԊ_֌\ٌ^݇_߃_߃_߃_߃_߃_߃_߃_߃_߃ } w x*3!<)E4N@ZOe^{pltzxnkjiiiiǑf͒bє^ҕ_Ցbڋb܈b܈b܈b܈b܈b܈b܈b܈b܈ ~ x {*3<'D2M?XMc]ml{wztnkjiih›fʜa̞`ΛcҖe֐fٌfٌfٌfٌfٌfٌfٌfٌfٌ  y ~)2;%D0L=WLa\kltzz}rljiijjɢfɢdʠfΚhӔiՐiՐiՐiՐiՐiՐiՐiՐiՐ  z )2;$C.K;VJ`Zikr{zvnklmnpƥkǥhǤj˟lЙlҕlҕlҕlҕlҕlҕlҕlҕlҕ  { )1:"C,K9UH^Ygjp{އv}}uppqrspĩlĩmȣo͝pЙpЙpЙpЙpЙpЙpЙpЙpЙ  | (1: B*J7SF]Xfim{؎tυ{|vtuvwu¬p¬qŧrʠs͜s͜s͜s͜s͜s͜s͜s͜s͜  }(1:B(I5QEZVch۝kzҕrɌx~|yyz{zutëuȤvʠvʠvʠvʠvʠvʠvʠvʠvʠ  }(09A&H3OCXTag֢iy͚qÒw|~|}~ywxŧxȣxȣxȣxȣxȣxȣxȣxȣxȣ  '09@$G1N@WRܮ_fҧgwȠnuz}z{ë{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ  '08@"G/M>VOس]dͫevålsx|}}}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ  '07? F,L;޼TNӷ\cȰctjpuz~z||¬|¬|¬|¬|¬|¬|¬|¬|¬  '/7>E)K7QLϼZaõashnsw{|yxvqsttttttttt  &.6=D%I4OJX__qekptx}}sppojlmmmmmmmmm   & . 5<B E2MHU]\obglptuymkjjfgggggggggg   & - 4;@A/KFS[Ym_|dhkyonuhffecc¬cĩcĩcĩcĩcĩcĩcĩcĩcĩ  %+2 7 8@,ICPXVj[z_b}fpigqc~baa_ê_ŧ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ #(-.:C)G@MURgVwY\s_gd`m^|]Ɍ]˞\ͯ[ȣZʠZ̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞  ",;B+E>IQMcPsRuUhX_^[jYyX܊XݛW߬VšUИVҕVҕVҕVҕVҕVҕVҕVҕVҕ / 9?,B=ENH^LlyOxmRcV\]XhVvUꄐU꓏T뢎S볍ŘQыQыQыQыQыQыQыQыQы پ/ 6;,>;AJCXzGdpKnfOw^T}X[UdTpS|RRQP~O}O}O}O}O}O}O}O}O}  ڴ",26*98n:He=Q\@XVE]RL`OScMZdKbdKjdJscI}bIaH`H`H`H`H`H`H`H`H`H`ѵ!&*$w./l18c4@[7FT;LN?OKERHKTFRUEXUD_UCgTCoTBxSBRAQAQAQAQAQAQAQAQAQӮȾu"!k&)a*1Y-8R1=L5AH9CE>ECCFAHG?NG>SG=YG<_G;fF:pE9vE9vE9vE9vE9vE9vE9vE9vE9vEɸ ti_$V!+O%0I)4E.7A29>6:<;;:?<9C<7H<6L<5Q<4W;3];2b:2b:2b:2b:2b:2b:2b:2b:2b:}rg ]T L%G)B",>&.:*/8-16115523821<20@2/C2-H2,M1+P1+P1+P1+P1+P1+P1+P1+P1+P1r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`s me"`,!g3&j=-iG7fRBb`L^nV[{[Z_[`[a\a\b]b]b^c^c^c]d[dZeXeXdXdXdXdXdXdXdXdt of"e+l2$p<+pE5nO@j]LdkW`w_^d]f]h^h^i_j_j`j`k_l^l\mZmYkZjZjZjZjZjZjZjZju pg"i)q1"u;)vD3uN?q[KkhWetbai`l`n`o`p`qararas`t^t[uZt\p\n\n\n\n\n\n\n\nu qi!m(u1 z:'{C1{L=xXJreWkqcf|lcrbuavbwbxbybzb{`|]}Z~\y^t^s^s^s^s^s^s^s^sv rj!q'z09%B/K;VHybVrmdkxofwd|c~ccccƒcЅ`؆\܇]߃_~`yawawawawawawawaww sk u&~/8#A-J9UF`Uzkdsuqk~|fddccbb̏a֏_׎`ۉb߄c~c|c|c|c|c|c|c|c|x tl y&/8!@*I6SD^ShczqrqzjfddefhǔgӔcӔd׎fۉg߃gၳgၳgၳgၳgၳgၳgၳgy t o}&.7@(H4RB\Qfbnrxvo}ihhikllИhИhӔi؎j܈jޅjޅjޅjޅjޅjޅjޅjޅy u r%.7?&G2P?ZOd`lq؀swzpmmnopqʜm͜lЙmԓnٌnڊnڊnڊnڊnڊnڊnڊnڊz v u%-6?#G/O=YMb_ڐjpчqww~rqrrstàqˠo̝pїqՐq؎q؎q؎q؎q؎q؎q؎q؎{ w x$-6>!F,M:WJޝ`]Ԗhnˎo}Æu~{xvvvwxvȣsɢtΛtҕtԒtԒtԒtԒtԒtԒtԒtԒ{ x z$-5=E*L8VH٣^[МgmƔm|sy~{yz{{{ƦvƦv˟vИvіvіvіvіvіvіvіvі| x |$,5<D'K4߭TEը]Yˠeklzrw|}}~~êyĪyȣy͜yϙyϙyϙyϙyϙyϙyϙyϙ| y $,4;C$J1۱RCѬ[Wƥcijxpuy}|Ƨ|˟{̝{̝{̝{̝{̝{̝{̝{̝} z # +3;B H-׶PA̰YVªahhwnsw|~zyêzȣzʠzʠzʠzʠzʠzʠzʠzʠ~ z  # * 29@޾F*ӺO@ȴWT_ffukquy~zwutqp¬rǥrȣrȣrȣrȣrȣrȣrȣrȣ~ {  # * 1 8?C(οM>ùUR]dcsinrv{zqmlkji¬jƦkȤkȤkȤkȤkȤkȤkȤkȤ|  ")/ 6 <@&K#H9QMW_]ob|fjxnlse}cbba`Ǥ`˟a̞a̞a̞a̞a̞a̞a̞a̞  $'(, ; E6MJT\Yl]ya{eoieo`{_^^]\̞\Ϛ\И\И\И\И\И\И\И\И/ :C2JFPXUhXv}[q_fc^l[yZZ™YīYſWіXԒXՑXՑXՑXՑXՑXՑXՑXՑ2 <B.GALTOdRrsU~gX^^YhWwVӇVԘUժT׾SٍSۉT܈T܈T܈T܈T܈T܈T܈T܈"2:>.B?FOJ^vMkjOv_SXZTeSsR䂅Q哄Q棃P終ÓOO~O~O~O~O~O~O~O~ Ӻ %06:.>fJ=pI?>;D>9J?7P?6W>5^>4f=3o<1{;1;1;1;1;1;1;1;1;Ÿ{ pf\S#L(F$,A'/<+19037535943>41C4/I4.N4-T3,[3*c2*f2*f2*f2*f2*f2*f2*f2*f2yn cYQ IB"=%9'6#)3&*1++//+-3++7+*;+(?+&D+%I*#O*#Q*#Q*#Q*#Q*#Q*#Q*#Q*#Q*f ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLf ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLg _U$T,!Y2%[<,YF5UR>R`EPoKP|MPNQOROSOSOTOTOUOUOVOVOVPVPUPTPTPTPTPTPTPTPTPh `V$X*^1$a;+`E4[O=X]FUlMTyQSSTTUUUUVUVUWUWVXVXVXVXWWWVWVUVTVTVTVTVTVTVTi aW#\)c0"f9)fC2bM<^[FZiOWuUVXVZWZW[X[X\Y\Y\Z]Z]Z]Y^X_W]XYXYXYXYXYXYXYXYj cY#a'h/ l8'lB0iL;eXF`eP\rXY~]Y_YaZaZbZc[c[d[d\e[fYfXfYbZ^Z^Z^Z^Z^Z^Z^Z^k dZ#f%n.r7$rA.qJ8mVDgbPbn[^zb\f[h\i\j\k\k]l]m]n\oYoZk\g]c]c]c]c]c]c]c]cl e_!k$s-x6"y?+xI6uSBp_Oik\cvf_l^p]q]s]t]u]v]w]xZz\v]q^m_h_h_h_h_h_h_h_hm fco#x,}5>(G3~Q@x]Nqg\jrhd{r`w_{^|^~]^_ƀ`؀^_|`warbmbmbmbmbmbmbmbmn hgt#},4=%F0O=ZKze[rniiwvc``abcddхcޅbc}dxerererererererern ijx"+4<"E-M:XIbYzkiprxizeeefghiɊiڊf܈gh}hwhwhwhwhwhwhwhwo jn|"*3;D*L7WF`VقhgypvqwljjjklmnՏj؎k܇kl|l|l|l|l|l|l|l|p kq!*2;C&K4VBܑ_TӉgeˁntyts{onnopqqΓnԓoٌo݇oလoလoလoလoလoလoလoq kt!)1:B#J0U?ח^QΏecňlrrzxurrsttuȗrїrՑrڋrބrބrބrބrބrބrބrބq lw! (19A I,ܢS<Ҝ\Oɕdajpp}u{|wvwwxx›vΚuҖu֏tۈt܈t܈t܈t܈t܈t܈t܈r my ! ( 08?G(اQ:ΡZMĚb_inn{sy|zzzz{z̞wϚwӔwٌwٌwٌwٌwٌwٌwٌwٌs n| ' / 6>ޯF#ԫO8ʥYK`]glmzrv|~}}}~~ɡ{̞zЗyՐy֐y֐y֐y֐y֐y֐y֐s o~ ' - 5<۳C!ЯN7ƩWJ_[ekkxpty}|zŤw~ɢx}Λx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕt p  &, 3 :ַA ̳L5UH]Yciivnrv{xusqpnǤo̞pїpіpіpіpіpіpіpіu r $*0޻6 Ҽ?ǷJ2SE[WaggtkptyxokjihfȤg̞hИhЗhЗhЗhЗhЗhЗhЗv u "&+. =½H0QCXT^ddrh~l}qrui}edccaʠbΛbҖbҖbҖbҖbҖbҖbҖbҖw y  ޿ ):E-N@UQ[a`oe{ivmkrc{``__^Κ^і^Ց^Ց^Ց^Ց^Ց^Ց^Ց^Ցx~ %7B)K=RNW^\l`xxdmhcn^x\\[ZZғZ֐ZڋZڋZڋZڋZڋZڋZڋZڋy  2?%G9NJSZWh{[tp^eb]jYvXXWVVъU܈V߄V߄V߄V߄V߄V߄V߄V߄{  Է"3GKDKGKMDSNC]OBgNAsM@L@K?J?I>G>G>G>G>G>G>G>GԤȳ {q#g'$^+,U/3O38I8JA5=5<5<5<5<5<5<5<5<ʮ y oe[ S#&L'+F+/A02=54::67@64F73M61T60\5.e5-o4,y3+2+2+2+2+2+2+2+2vl b YPI C$="'9&*5*+2/,04--9-+>-(D-'K,%R,#Y+"a* k) k) k) k) k) k) k) k)ti_ VMF ? 94!1".#+$$)(%',%%1%#6% ;%@$F$L#S"S"S"S"S"S"S"S"YOE'F-!I3%I<+GH2EU8CcJ>J>K>K=L=L=M=M=N=N=N=N=N=N=N=N=N=ZQF&L*P0#Q:*OD1LQ9I^>HmBH{CICJCKCLCLCMCMBNBNBOBOBPBPBPBPBQAQAQAQAQAQAQA[RH&P(U."W8(UC0QN9N\@KjDLxFLGMGNHNGOGOGPGPGQGQHRHRHRHRHRFSDSDSDSDSDSDSD\ SL$U'Z- \7&[A/VL8SY@PgGOtJOLPMPMQMQMRMRMSMSNTNTNTOTOTNUKUIUIUIUIUIUIUI^ TP"Y%`,c6$b@-_J6ZV@VcISpNS}QSSSSTTTTTTUUUUUVVVVWVWVWWSXPXNXNXNXNXNXNXN_ VU _"g+j4!j>*gH4bS?]_IYlRWxWVZV[V\V\W]W^W^W_X`XaWaY]ZZZV[S[S[S[S[S[S[S` WYd!m*q3q<'oF1lP=f\I`hT[s\Y~aXcXeXfXgXhXiXjXkXlZh[d\`]\^Y^Y^Y^Y^Y^Y^Ya X^j s)w2x;#xD.uN:oYGhdTbn`]yg[lZnYpYqZq[q\q]q]q]o_j`f`ba_a_a_a_a_a_a_b Zbo x(}1: C*~K6yWDraRjkabsl]}t]v]w^w_w_w`wawawavbqclcgddddddddddddddc [gt}'09A&J2U@{_Psg`jomdxvbza|b|c|c|d|e|f|e|ewfrfmgigigigigigigid ]jx&/7@"I.T<ۃ]L{e]smlltvh|}ffghhij́jၪi|iwjrjnjnjnjnjnjnjne ^n{ & .6?G*ޑS8Պ\J͂c[{jitqunx~kkkllmmƅnچmm|mwlslslslslslslsf aq  % -5=F%ڗR5АZGljbXhg{otuu~q|ooopqqrԊp݇pၔo{owowowowowowowg dt  $ + 4<ߟE ՜P3̕YEŽ`Vgemr|r}wytsssttuΎsٌsޅrq{q{q{q{q{q{q{g fw #* 2 :ۤCѠN0ǚXC_Teckpp{}vy|wvvwwwȒvՐuۊt߄ttttttth i z ")0 7بAͤL.ÞVA^Rdainnzs~yzyyyzzÖyҕ~x؎~w܈}v߃}v߃}v߃}v߃}v߃}v߃}v߃i k |!'-ެ4 Ӭ?ɨK,T?\Oc_hlmxqv|}}|{}y}w~u}ϙu|Ԓv{ًuy݇uy݇uy݇uy݇uy݇uy݇uy݇j n  $)۱.ϰ=ŬI*RdD=qC<~A;@;?;>:=:<:<:<:<:<:<:<ϤIJw md"[&"S+)L//F43A:6=@8:G98N96W85a84l72y514030201010101010101Ů~tk aYPJ"#C&'>+*90,66.3<.0B/.I.,Q.+Z-)d,(o+&y*%)$($($($($($($(|qg^ V MF?: 5!#1%$.*%,/&)4&&:&#@&!H%P$X#`#j"q!q!q!q!q!q!q!|od[R JB;5 0,)&#!!&+06<CIQWWWWWWWKA8)=, ?2#><(0?/?/@.@.A.A-B-B,C,C,D,D+D+D+D+D+D+LB;(A*C0#B9(AE.>R2=`5=o6=}5>5?4@4A3A3B3B2C2C2D1E1E1F0F0F0G/G/G/G/G/G/G/MC>&D(G."G7'EC.BP3A^7@l8@z8A8B8C7D7D7E6E6F6F5G5H5H5H5I5I4J3J2J2J2J2J2J2NDB$H'K, L6&KA-GN4E[9Di;DwGs@H@I@J@J@K@K@L@L@M@M@M@N@NAO?P=Q;Q;Q;Q;Q;Q;Q;QFJ R"X)[3"Y=)UH2PT;MaALoDL{FMFMGNGNGOGOGOGPHPHPIPIQHSETCT@T@T@T@T@T@T@RHOX_(b2a;&^E0XP:T]BQjIPvLPMPNQOQOQPRPRQRQRRRSRSUOWLWIXFXEXEXEXEXEXETIT_g'j0j:#gC,bM7]ZBXeKUqRT|USWSXTYTYTZT[T\U\U\V[YWZS[O[L[K[K[K[K[K[KULYem&q/r8pA(lK4gW@`aL[lVWv\V`UbVbWcWcXcYcYcZcYc\^^Y^V^R^Q^Q^Q^Q^Q^QVP^ks%x-y6x?$vH/qTF*zR8t\GldVemb`uj_m_n_n`n`nanbobobodkdfebe]e\e\e\e\e\e\X Xg t }# *3<E%݃Q3|ZCtbTmiagqkdzpcscsdtdtetetftftgrhlhghchbhbhbhbhbhbY \k x " ) 1:D ؊O/σXA|`Qug_onjjurh~vhxhxhxixixjyjykwkqkmjhjfjfjfjfjfjfZ _o {!( / 8ݔCӏN,ʉW>^N|e]vkiqrrnyxl{l|l}m}m}m}n}n}nwmqmllklklklklklk[ b r &- 5 ٙAΔL*ŎU<]LcZ}igworsvyq}~ooopppŁpۂp{pvoqoooooooooooo\ e u$+ߝ2 ԝ?ʘK(T9[IbXhe~mpyryuysrrssssֆs rzquqsqsqsqsqsqs\ g x!'ۣ-С=ƝI%S7ZGaVfckn~pxzuw}uuvv~v}vъ|vބ{u~ztyzswzswzswzswzswzsw] j z!צ*̥;¡H#Q5YE_Seailnws{y}yzyxyvytzszˍsz܈sxrw|rv{rv{rv{rv{rv{rv{^ m }ޥҪ'Ȩ9F!P2WB^Qc^hjlup{ut~}p}n}l~k~iǏjڋj}ޅj{jz~jz~jz~jz~jz~jz~_ p٪ έ$ì7DN0U@\Nb\fhjs}n}trlygedcbĎbڋcޅccccccc` t  إҮȲ!5 BK-S=ZK_Ydehpwl{npew`_^]]Ê]܇]]~]}]}]}]}]}]}e x ٠ҩ˱¶1 ?I)P9WH\Uab{emqixgn_u\[ZZYÃY܁Y}YyYxYxYxYxYxYxi}ܙӤ̭Ķ-;E&M6SDXQ}]^taijesak|ZsXWV~V}U{UzUwVsVrVrVrVrVrVro֞ͩŲ(7A!I1O?TMvXYl\ebanZguVqxT~xSwSuRtQrQqQnRkRkRkRkRkRkRkuڗУǮ!1 <D+J:wNGmRTcW_Z\gTdlQonP|mOlOkNiMhMgMeMbMbMbMbMbMbMb~ӝɩ* 6>%xD4nHAdLMZQWSW^O`aMlbLzaK͉`KΙ^Jϫ]I[HZHYIWIWIWIWIWIWIW̥ٗð'0x7 n=-dA9[FDSKMMRRJ\THhTHvSGQGPFOEMDLDKCJCJCJCJCJCJCJޏПŬ$ w+m1c5)Z93R>;KEAGMEDVFCaFBnEA|DAC@A@@??>>>=><><><><><><ԙǨ~u l$b)Z.%R3,J82E>6AE9>M:6-:'*E&(N&&W%$b$"n#!z"! xlbZR JC <61. *%(*$/!5<DMV`jvyyyyyyxk_VNE > 72- ($!!&+1 9 @HPY[[[[[[>4"1(5+61!4;%2G(0T*0b*0q*0~)1(2'3&3&4%5$5$6#6#7"8"9!9!9 : : ::::::?5!4'8)9/ 89%6E)4R+4`,3n,4|+4*5*6)7(7(8'9'9&:&;%;%<$<$=#=#=#>">">">">">"@6!7$<'=, =7$;C)9P-8].7k/8y.8-9,:,;+;+<*<*=)>)>)?(?(@'@'A'A&A%A%A%A%A%A%A7 ;"@$B*C4#A@)>M.0?/@/@.A.A.B.B-C-C-D-D-E+E*F)F)F)F)F)F)B8 @E"I(J2!H=(EI.BV3Ad5Aq6A~6B5C5D5D4E4E4F4F3G3G3G3H4H3I1J/J.J.J.J.J.J.C;DKQ'R1P;&MF-IR4F_9Em;Fy;G;G;H;H;I;I;J;J;J;K;K#dH._T9Y^DUiLStQR~SRTSTSTTTTTUTUTVTVUWRZM[J\G\D\D\D\D\D\DIN[g n"r)s2r<nE(iQ5c[B\dNXnVWxYWZWZX[X[Y[Y[Z[Z[Z[[Y]T_P_M_J_J_J_J_J_JJS` l t x( z0z9xC#sO/mY?eaM`jW]s]\|`\`\a]a]a^a^a_a_a_ab[cWdSdPdPdPdPdPdPLVe qy~& . 7A|M*uW;n_JhfWcn_awd`f`fagagbgbgcgcgcgfbg]gYfUfUfUfUfUfUMZ i u}$+ 4ۈ@уL'|U8v\HodUjk_gsfe{jekekelflflflglgligibi^hZhZhZhZhZhZN] lx"(0 ֍>̈J%ÂS6|[EwbSqh^mogjvlioipipipiqjqjqjqkmkgkcj_j_j_j_j_j_O` p{%ܓ,ё<ǍH"R3YB}`Pxf\slfpsnmzrltlululululumvnrnlmhldldldldldldRc s  ؗ)͕;ÒG P0X@^N~dZyjetonqvto~woxoyoyoyozozpwpqolnhnhnhnhnhnhT fv ߗӛ'ə9FO.W=]KcXhczmmvrtsyyr|q}~r}}r~{r~yr~ys{ysuxrpwqlwqlwqlwqlwqlwqlW ix ڛ Ϟ$ŝ7 DN,V;\IaVfakk{ot~wv{zu~wuuusuqupvÁowpvyputotootootootootootoZ l{  ٘Ԟʢ"5 BM)T8[F`Sd_ijmsx}r|qzymykyizhzfzf{؂g{{gyvgwrgwrgwrgwrgwrgwr] oۓԛϢŦ3@J&S6YC^Pc\ggzkqqo{ivdba`_^ԁ`|`w`}s`}s`}s`}s`}s`}sas֗ϟɦ0>H#P3W@\MaY}edtiokmxcs^}\[[Z~Y}[y[u[q[q[q[q[q[qewڑқʣª,;E M/T=YJ^Vxcangkekt^r{Z}}X|X{WyVxVwWsWpWmWmWmWmWmWmi|Ֆ͟Ĩ'7BJ+P9VEz[Qq_]gcg_ioYqtV|uUuTsTqSpRoSlTiTgTgTgTgTgTgoڏЛǤ"2 >F&L4{RArVLiZX`_aYfhTolR{lQkQjPhOgOeOcOaP_P_P_P_P_P_vԕʠ,8A |G.tL;jQGaUQYZZSb`OlbNyaM`M_L]K\KZKYKWKUKUKUKUKUKU~ڎΛħ #1 }:tA'kF4aK?YOIRUPM^TKiUJvUIƅSIƔRHǦPGȹOFNFMFKFJFJFJFJFJFJICC_PROFILE Ӗǣ|)t3k: a?,XD7QI?KQEHZGFfGEsFE؂EDْDCڣBC۷AB@A?A?@>@>@>@>@>@>ُ˞zr$ i+`1W6&Oy8>7=6=4<3;2;1:1:1:1:1:1:1ϙçwog _$V)O/!G4'B;,=B/:J08T07_/6l.5z-4+4*3(3'2&2%2%2%2%2%2%Ƥtld\ TM!F&?+ :1#68%3?&0G&.Q&-[%+g$*v#(!( ''&&&&&&ti`YQ JC<7!2'/-+3(9%A#J!T`m{th]UMF >8 2.*& #& +18AJU` k wuh\QIA9 3 .($ !' -5>GPYaaaaaa1'&*',*,1): &F"%T#%b"%p!%} %&'(()**+,-...........1'&-%/(/.-8!+D#*R$)`$)n#)z")!* +,,-../01222222222223)$0#4%4+36!1B$/O&.]&.k%.x$.#/"0!1!1 233456667777777774-!5 8"9':3 8?$5L'4Y)3g(3t(4'5&6%6$7$8#8#9"9":";!;!A&B0@<$(>(?'@'@'@'A'A&B%B$C#C"C"C"C"C"77@DI$K.H8"ED(AQ-@^0?k1@w0@0A/B/B/C/C.D.D.E.E/E/F/G-G+H*I(I(I(I(I(I(8<ELR"T,R6M@&IL.FY3Ef5Er6F}6F6G6G6H6H6H7H7I7I8I8J6L4M2M0N.N.N.N.N.N.:ALU[!]*[3W="RH,NT4K`9JmK>L?L?L?M?M?N?N@O>P;R8R6S4S3S3S3S3S3;FR\ c e(e1a;\D'WQ2S\;PgAOrDO|EOFPFPFQFQFQFRFRGRGSFUBV?WtJ$nS4h[BccM_lT^tW]}Y]Y^Y^Z^Z_Z_Z_Z`[aWcRdNdKdJdJdJdJdJHX f qy~$ނ-Ԁ<{H!vQ1pY?j`KfhTcpZbx]b^b_b_b_c_c`c`c`d^fXgTfPfOfOfOfOfOK [j u|ه)υ:ŁF|P.wWG!N.~S:vXFn]Pea[]gcWohTyjSiRhRfQePcPaQ^Q\Q[Q[Q[Q[Q[pԍʘ-9CI)wO6oTAfXK^]TWd\Rl`Pw`O`O^N\M[MYLXMVNTNSNSNSNSNSv܆ϓŞ&4 =xD#pJ0gO;^SEWYMQ`SMiULuUKTKSJQIPINHMHKHJHJHJHJHJHJ~ԍɚ,x6p>gD(^I3WN=PTDK\HIfIGsIGGFFFEECDBDAC@C?C?C?C?C?C?܆͕áy t n- f6^< VB*OH3IO8EX;Dc3=3=3=3=3=3=3ӏƝzojc$ [,T2L9"F@(BH-?Q.=\.=i.7!:>$7G%5Q%4\$3i#2w"1!0//.......|pe]V P IB!;'6-24/;,D*M)X'd%s$#"!!!!!!!}peZSLE > 82."+('.$5 =FQ]k{~qdYNG@94 . )%"!&-4= GS_ly rdXMC;4.) $    ")1; F P Z e h h h h h $'#'$)!09FTao| !!! ! ! ! ! ! ! ! ! %!%%$''%-!7 DQ_my  !!"##$%&&&&&&&&&&&&$")!+#*))4&A%N$\$j$v$%&&''())++,,,,-,,,,,,'(.0 0&11.>,K!+X!*f *r+~,--../001223333333333(-479#:.8:4G"2T$2a#2n"2z!3 44566788999:::;;;;;;*3:?C!C+A7=C#:O&9\'9i&9u&:%;$;$<#<#=#=">"?"?"?"?"@!A ABBBBBB-9AGL M)J3F>!BJ'?W*?d+?p+@{*A*B*B*B*C*C*C*D*D+D+E*F)G'G%H$H#H#H#H#H#2?GP VV&T0P:KF%GR,F^/Ek1Fv1F1G1G1H1H2H2I2I2I3J3J3K0L.M,M*N)N)N)N)N)7CN X ] _% ^-Z7TA!PN*MY2Ke6Kp8Kz8L9L9M9M9M9N:N:N:O:O;P8Q5R3S1S/S/S/S/S/<I T _eg" g* d3`?[K%VU2R_:Qj=Qs?Q|@Q@Q@R@R@RASASASASBT?Vo_HjeQglVfsZe{\d]d]e^e^e^e_e_fZgUhQgNgNgNgNgNQ`nw~Ղфȇ2?I!|Q/xW;t]FpcPliWio\hw_gagbgb~gc}gc{gcygdzi_{jZ{jUziRziRziRziRziRScqz؁ц̈Ë0=HO,~V9y[DuaNqfWnl]lsb|k{ezjfxjgvjgtjgrjhpjhqldrm^rlZrkVrkVrkVrkVrkVVgs}Ԅ͉nj-<FN)T6ZAz_LvdU}si^xpodtnwhqnjonkmnkknkinkgnkhohjpbjp]jnZjnZjnZjnZjnZYjvڀчɌ+: DM&S3X?]I|bSxyf]qvlelssjhr|merncrnbrn`sm_sm_tjaudbt`br\br\br\br\br\]myփ͋Ő(8 CK#R0W<\Fz`Qsd[k|iddzoj`xxn]xo\xo[ynYymXykYziZzd[y`[x][x][x][x][x]`q}҇ɏ $5AI P-U8}ZCv^NnbXfga^mhYvlWlVkVjUhTgTeUaV]V[V[V[V[V[duف΋œ1=GN)S5xX?p\JhaT`e\YlcUufSfSeRcQbQ`P^Q[RXRVRVRVRVRViyԆʐ,9 CJ$zP0rU;jZEb_O[dWUk\Ru^P^P\O[OYNWMVNSNQNPNPNPNPNPoϋŕ&5 ?{FsL+kQ6cV@[[HUaOPiTNtUMTLRLQKOJNJLJJJIJHJHJHJHJHvօʑ.z9sAkG%cL/\Q9UWAO^GKgIJrJIIHGHFGDFCFAF@E?E?E?E?E?E?~όĘ|x&r2 k;cA[G(TL1NR8IZEo=D|ʈ->ʘ,=˪*<);(;(9)9)9)9)9)9)͏ui_[V&P/J6D>?F >>???@AAAAAAAA0;B K P P$M,H7CC@P#@]$Ai$Bt$B}$B$C%C%D%D%D&E&E&E&E'F&G$G#H!H H H H H 6@ J TXY W) R3M?JL"HX'Gc*Gn+Hw,H,I-I-I-J-J-J.J.K.K/K-L+M)M'O&O&O&O&O&; F Q[`a`%\. X<THPS)N]/Mg2Mq3My4N4N4N4O5O5O5O5O6P6P5Q2S0T.T,T+T+T+T+? KWa fhg d*b9^EYO)UX2Sb7Rk9Rt:R|;S;S;S;TWn@WvAW~AWAXAXBXBXBXCXCXCY@Z<[9[7[6[6[6[6F Sainpo r"q4 nAiJ#dS/`Z9^b@\jD\rE[yF[G[G[G[H[H[H[I[I\F]B]?^<^;^;^;^;JXdlqttww2t>oH kQ-gX8d_@aeF_mI^tK^|L^L^M^M^M^N^N^O^L`G`DaAa@a@a@a@M[houxy{|/y=uGqO*mV6i\?fbFciLbpOaxPaQaRaRaSaSaS~aT}aQ~bL~cH~dE~dD~dD~dD~dDP^jsy|}-~;zEwM'sT3oZ=k_FheLelQdsTd{V~cW|dW{dXydXwcXvcYudWveQvfMwfIwfIwfIwfIwfISbmv|ʀÁ+9 D|L$xR0tX;p]DmbLjhR{hoWxgwZvf[tf\rg\pg\og]mf]lg[mhVniQoiMoiMoiMoiMoiMUepy΀Ƅ(7 BJ"}Q.yV8v[Br`KyoeStlkYpks]mj|_kj`ij`gj`fj`dj`ck_elYflUglQglPglPglPglPXhs|ʃ‡%5@IO+U6{Z@{x^ItucRnrhYhpo_enxbbnc`nc_oc]oc\ob[oa]p[^qW_pS_pR_pR_pR_pR[kwЀLJ "2>GN'S3}X=v~\Fo{aPhxfXbvl_]tucZtdYtdXucWubVuaUv`Vv[XvWXuSXuSXuSXuSXuS_n{̄Ë/<EL$Q/yV:q[Cj_MbdU\}j\W|s`U|~aT|`S}_R}]Q}\Q~[R}WR}TS}QS|PS|PS|PS|PdsȈ,9 BJ {O+tT6lY?d]H]bQWiWSr[Q}[PZPXOVNUNSNQNNOLOLOLOLOLix΄č&4?|GuM'nR1fW;_[CXaKShPOqSN}RMQMOLNKLKKKIKGKEKEKEKEKEo~ʉ /|: uBnI!gN,`S5YY=S_DNgHLqIK}IJGIFIDHBGAG@G?G>G>G>G>G>vЄď~z(t4 n=gD`J%YO.RT6M[;Id>Go>F{>FXDQI&KP,GW1D`3Bl3Ax2A0@/?-?,>*=*<*;+;+;+;+;+Іēxkc`![-U5O<ICDJ!@R$>\%61,($  $ + 4 > I Vewwj]QG<3,'" "*4?L[k|zl^QF;1(!  )4AN[hvxxxx '$$&,6DR_l x %!!# ) 4BP]j v                   "%1>LZ f r }     ".;HVcoy            #'&*)+&7#D!Q!^ j u!"# $ $ % & & ' ( ( ( ( ( ) * ) ) ) ) ) "*.254&13-?+L*Y*f+q+{,-..//011 1 1222222222(1 6 = @ ?#;-7:3G2T3a4l5v66777889999:::;;::::.7 > FJI E)@4>>???@@@@AABBBBBBB3 = FO RRO% J/ F<DICVCaCk Dt!D|!E!E!E"E"F"F"F#F#F#G#G"H IJIIII9 BNV ZZXS)Q8MEKP!J[%Ie'In(Jv(J~)J)K)K)K*K*K*L*L+L+M)N'N%N$N#N#N#N#= GT[_ _]\%[5 WBSL!PV)O_-Oh.Oq/Ox0O0P0P0P1P1P1P2Q2Q2Q0R.R+R*R(R(R(R(AMY`cca d!c2 _?[I XR)UZ0Tc3Tk5Ts6T{6T7T7T7T7T8T8T8T9T7U4V1V/V.V.V.V.EQ]chigjj0g=cG_O(\W1Z_6Yf9Xn;WvW>W?W=X:Y7Y4Y3Y3Y3Y3HU`gmomop-m:iEfM&bT0_[7]b<[i?[q@ZxAZBZBZBZCZCZDZDZC[?\<\9\8\8\8\8KYclqsrtu+s8 oClK#hR.dX7a_=_eA^lD]tE]|F]G]G]H}]H|]Iz]Ix\Iy^Dy^@y_>y_{FxM&tR0qX9{n\AukbHphhNmgoRjfxTgfUffVdfVbfV`fV_fV`gQahLbhIchGchGchGchGVeqy0<D}K#zQ-}wV7vt[?pq_HjneOellTaktW_j~Y]kY\kXZkXYkWWkWXlSZlN[lK\lI\lI\lI\lIZiu}-9 BI O*x}T4rzY=kw]EdtbM^riTZqqXXp{YVpYUqXTqWSqVRqURrQTrMTrKUrIUrIUrIUrI^mxǁ)6 @GzM&tR0mW:f~[B_|`JYzgQUxoURxyVQxUPyTPyROyQNyPNyMOyJOyHPxFPxFPxFPxFbr}Æ%3=|EuK#oP,hU6aZ>Z_FTeLPnONyPMOMMLKLJKHKGKDKCKBKBKBKBhwɂ /}: vBpIiN(bS1[X9U]@PdEMmGKxGJFJEICHAH@G?G=GiEcK"\P+VV3P\9Lc=Im>Hx>G=G;F9E8D7D5C5C4C4C4C4C4v˃}v s!n/h8 b@[FUL$OR+JY0Ga3Ek4Cw3C2B0B/A-@,?+?+>+>+>+>+>+}Ŋzmgd&_1Y: S@MGHM"DU&A](?h(>t'=&=$<#;!: :8 7!7!7!7!7!ˆtf[WT'O1J9 E@@G-:6 6? 3H2R0]0j/x .Έ -Ι ,ϭ + * ( ' &&&&{obWLB730-'*1(;&F%Q$]#l"|! ~qdXMC9/,(%!#,6@LXhy    seYNC9/'# % . 8DQattgZNC8.% $.:HYl~wi[NB7-# #/>N_o|$ " "$*5C Q ^ kw " !&2@ N [ ht~ #0=K X e pz     ,9G T a l w    " )5BO\ h s |       $ & + - ,$(0$="J!W !c "n #x $%%&&''((()*** * * * * * * %+ / 78 7 3+.8,E+R+^ -j .t /} / 0 0 1 1 2 2 2 3 3 3 4 3433 3 3 3 + 2 :A CA=& 81 4?4L5Y6e7n8w899:::;;;;;;<;;<<<<1 8CIKJF @+>9 =G>S>^?h?q@y@@AAAAABBBBBCCCCCC6>IOQPMK%I5 GBFNEXEbEkFsFzFGGGG G G G!H!H HIIHHHH;DOTVUP T!S1Q>NILS K\#Ke$Km%Ku%K|&L&L&L&L'M'L'L(L(L(M%M$M"M!M!M!M!?ITY]]Y\\.Y;VFSO"QW'P`*Ph+Po,Pw,P~,P,P-P-P-P.P.P/P/P,Q)Q(Q&Q&Q&Q&BNW_cd`bc+`9 ]CZL!WT(U[-Tc0Tj1Sr2Sy2S2S3S3S4S4S5S5S6T2T/T-T+T+T+T+ER\dhjggh)g6 cA`I]Q(ZX/X_3Wf5Wm6Vt7V|8V8V9V9V:V:~V;}V;|V8|W4{W2{W0{W0{W0{W0GU`hmnlln&l4i?fGbN&_U.][4[b8Zh:Yp{Y>yY?xY?vY@tX@tY=tZ9tZ6tZ4tZ4tZ4tZ4JXdlqsqp r#q2o=kEhL$dS-aX4_^9}]d=z\k?x\sAv\|Bu\Bs\Cq\Co\Dm\Dk[Ek\Bl]=l];m]8m]8m]8m]8N\hptvuu v v/s; pCmJ!jP+gV3{d[9wba>s`gBp_oEn_xFl_Gj_Hi_Hg_He_Ic_Ic_Fd`Ae`>e`;e`;e`;e`;Q`ksxzzyzz-x9 uBrIoO(|lT1viY8qg^?ledDickHfctJdb}KbbL`cL^cL]bL[bL[cI\cD]dA^d>^d>^d>^d>Tdov{~~}~~*}7 z@wG}uM%xrR.roW7ll\>fjaEbhhJ^gpM\gzNZgNXgNWgNVgMTgLTgJUhFVhCWh@Wh@Wh@Wh@Xhrz'4>}Ey{K"sxP+mvU4gsZG~=G};G|:G|9G|9G|9G|9hvĀ|)v5p=jDdJ^O'XT/RZ6Ma;Ji=Ht=G+>+>+>+uƂyojf)b3\< VCQIKO!GV&C^)Ah*@s)?(?&>%=#<"3*"$.9 F Sct~pbVJ>4*" &1>L]prdWJ>3)   '5DVi}tfXK>2(*:L_q"" ( 3 AP]iu~ $ 1 > MZfr{    " . ; IVbnx   * 7 E R^jt}         ' 3 @ N Z f p y    # % #" . ; H Ualu} """""!!!! % */ 0.*) %5 #C "P#\$g%q&y'(())**+++,,,,, + + + + ' ,5:;83"..+<-J.W0a1k2s 2{ 3 3 4 4 4 4 5 5 5 5 5 5 5 6 6 6 6 6 -3<AB@;6&767D 8Q 9[:e:n;u;|;<<<<<===========3:CGGD> B!B1A?@K@VA_AhAoBwB}BBBCCCCCCCCCCCCC7@IMPOHLL.J;HFGPGYGbGjGqGxGHHHHHHGGHHHHHHH;EMUXXQTU*S7 PBNKMTL]!Ld"Ll"Ls"Lz#L#L#L$L$L$K%K%K&K$L"L!L LLL=IT[__ZZ\'Z5 W?UHRP!QX$P_&Of(On(Ou)O|)O)O*O*O+O+O,O,O*~O(~O&}O$}O$}O$}O$@MYadea`a$`2^=[EXM!UT&T[*Sb,Ri-Rp.Rx.R/R/R0}R0{R1zR1xR2wR0vR-vS+vS)vS(vS(vS(DR^eijge f!f/c:`C]JZQ&XW,W^/Vd1}Ul2|Us3zU{4xU4wU5uU6sU6qU7pU7nU6nU2nV/nV-nV-nV-nV-HVbimnljkk-h8 eAbH_O%]T,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;gXf[>d[?c[?a[?_[@^[?_[:_\7`\5`\4`\4`\4N^ipuvurss(r4o=mD|jK!wgP)qeU0lbZ6ha`;e`g>b_pA`_yB^_B\_B[_BY_BW_BV_BW_=X_:Y_8Y_7Y_7Y_7Sbmtxzzwwx%w1t; ~rCxpIrmN&mkS.ghX5bf^;^dd@ZclCXcvDVcEUcDTcDRcCQcCPcBQd>Rd;Rd9Sd8Sd8Sd8Xfpx|~~{{|!{/z9 zxAtvGnsM#hqQ,boV3]m[:Xkb?TijCRisDPiDOiDNiBMjALj@Kj?LjIq=Hr;Gr:Gq8Gp7Gp5Go5Go5Go5boy{'v3p< jCdI^N$Y~S,S|X2N{^7Kzg:Iyq;Hy|:Gz9Fz7Fz6Ez4Dz3Cy2Cx1Cw0Cw0Cw0Cw0ht~xt"o/j8 d@_FYKSQ&NV,J]1Gf3Ep3D|2D1C/B-A,@*@*?*>*>*>*>*nzzplh)c4^< XCSINN IT%E\)Ce*Ap*@|(@'?%>$=" LEGLCR@Z>d %I$S#_"l!{ug[NB6," !,8DP^ n  ВЧxj]QE9.%  #/<K[m{m_SF:/$ &4EVi}~oaTG:/$ +=PdxqcUH;.$!3G\o    $2@N[fqz    ! /=KXcnw     +9GT`kt|      (5CP\gpy     #0>KWblu}       +9 F R ^ h q y  #('$ %2@MYcmu|  !""###$$$$$$$$"%-10-("*"9%G'T(^*g+p+w,},----......//....(-6872,-#/31B2N3X4a4j5q5x 5~ 6 6 6 6 7 7 7 7 7 7 7 7 6 6 6 6 .5<?A>69:.:< :H ;R <\ >>>>========1;BJLIBDE)C7 BCBMBVB^BfCmCtCzCCCCCCCBBBBBBBB4@KRTSLLN&L3J>IHHQGYG`GhGoGuG|GGGGGGGGGGGGGG9EQX[[TRU"T0R;ODMMLTK\KcKi Kp Kx K!K!K!K"K"}J#|J$zJ#yK!xK xKxJxJxJ=LW^aa\Y ZZ-X8 UARIQPOW"O^#Ne$Nl%Ns&}N{&|N&zN'xN'wN(uN)sN)rM)qN&pN$pN#pN"pN"pN"AQ\bffb^__+]6 [?XFUMTS$}RZ&{R`(yQg*wQo*uQw+tQ,rQ,pQ-oQ-mQ.kQ/iP/iQ+iQ)iQ'iQ&iQ&iQ&EU`fjjgcdd(b4`=]DZK{XQ$wVV(tU\+qTc-oTk/mTs0lT|1jT1hT2fT2dT3cT3aT4aT0aT-aT+bT)bT)bT)IYdjnnlhhh%g1e; bB{`Hv]N#q[T(mYY-jX_0hXg3eWo4dWx5bW6`W6^W7\W7[W7YW7YW4ZW1ZX.[X-[X-[X-N]gnqrqllm"l/j8 |g@veFqbL!l`Q(h^W.d]\2`\c6^[k8\[u9Z[:X[:W[:U[:T[:R[9S[6S[3T[1T[/T[/T[/Sakquvupp qp,}o6 xm>rjEmhJhfO&cdT-^bZ3Za`7W`h:T_r;S_|s(>r(>r(>r(hs|zp lh)c3^; YBTGOMJS#FZ'Cb)Bl)Ax(@'?%>$="=!<~!;}!:|"9{"9{"9{"nyvic`#\.X7S> NDIJEQAX?a =k N;V9_8j7v6554320////||m^QJGE)A3=;:B 6J 4S2\1g0s 0 / . , +*) ( ' ' ' ugYL?864(22/:-C+M)W(b'n&|%#" {m_RE9.% #"$ .8BMXetrdWJ>1'  %1<IVewljƝƳugZMA4) *6DSdwً٠ظxj\OB6* !/>Nau{l^QD6+   &6H\q~o`SE7+  .BVj}   "0>KXdox   -;HUaku|   )8EQ]hqy  %3@MYdmu|  !.;HT_iqx~(5COZdltz  " . < I U_hpv}&'% %5DP Z!c"k#r#y$$%%%&&&&'''''&&&"'.//) #'0)>+J,U-^.f.m/t/z//00001111000///&.6<=8003*484E5O6X6`7g7n7u7{ 8 8 8 8 8 8 8 8 8 7 7 7 7 7 7 *4@FGD>;=%=3=? =I =S =[ =b =i =o=v=}==>>>=======<<0=HNQNGDF!F/D: CDCMBUB]BdBjBqBxBBBBBBB~B|B{B{BzAzAzA4DOUXVPL MM,K7 I@HIGQFXF_FeFlFsF{F}F|FzFyFwFuFtFsFrFrErErE9JU[]\WRSS(R4O=MELLKSJZ}Ja|IgzIoxIvwIuJtJ rJ pI!nI!mI"lI kIjIjIjIjI@OZ`ba]XXY&W1U: SBQI{OPxNVvM\ tMc"rMj"pMr#oM{$mM$kM%jM%hM&fM'dL'cL%cM#cM!cL cL cL ET^dffb]\]"\/Z8 ~X@zUFuSLrRR!oQX#lP_%jPf'hPn(gPw(eP)cP*bP*`P+^P+\P,\P*\P'\P%\P#\P#\P#JXbgjjgaa aa,_6 z]>uZDpXJlVO!hUU%eT[(cSb*aSj,_Ss-]S~.\S.ZS.XS/VS/US/TS-US*US(US&US&US&N\eknnlfe fe){d3vb<q`Bl]Hg[M cZS&_XX*\X_-YWg/XWp1VW{1TW1SW1QW1PW1NW1NW/NW,OW*OW)OV(OV(S`iorsqjjj|j&wi1rg9 le@gcFbaK^`Q%Y^V*V]]/S\d1Q[m3O[x3N[3L\2K\2J\1H\0H\/H[,I[+I[*I[)I[)Xdmrvwvoo{nwo#rn.mm7 hk>cjD^hJYfO#UdT)PcZ-Mbb1Kak2Iav2Hb1Gb0Fb/Eb.Db-Cb,Ca*Ca)C`)C`(C`(\iqvz|{u}tutqtmt+hs5cr< ^pBYoHUmM PkR%LjY*Hi`-Fij.Eiu.Di-Ci+Bj*Aj(@j'?i&>h&>g&>g%>f%>f%bmu{|yzpz kzgz'cz2^y: Yx@TvFPuKKsQ!GrW%Dr_'Bqi(Aqt'@r&?r$>r#=r!{h ={s<{;{:{9{8{8z6y5w4v4v4vnxrd[ WT(Q2M9H@ DF@M=T:]9g8r76543310///t~}m`RMK!H+D4@<=C 9J6R4[3e2q1~0 / . - , + * ) )){xiZMB><#9-653=1F/N-X,b+n*{('&$#"!   qcUH;0,+!)+'4%=#G"Q \hvwi\NA4)&0;EQ ] l ||n`SF9-" !+7CO^nrdVI<0$%1>L\pЄЙϯufYL>2&)7GYoxi[N@3'!1BUk|l^PB4' )<Pez  .;IVblt| +8FS^hqx  '4BOZdmu{  #0>JV`iqw}*8EQ[dlsy   $1?KV_hou{  *9FQZcjqw }  ! 1?KU^fmsy!',+$,!:#F$Q%Y&a&h'o'u({((()))))))))((((3994+'+&,5.A/K/T0\0c1j1p1v1|11112211111100%2=CD@936!6/6;7F7O7W7^7d7k7q8x 8 8 8 8 8 8 8 8 8 ~7 }7 }7 }7 }7 *<FLMJC= ??+>6=A =J =R =Y =_ =f =l =s =z===~=|={=y=w=v=u<u<t<t<3CMSTQKEFF'E2D< BEBMATAZAaAg}An|AvzA~yAwAuAtArApAoAmAmAl@l@l@:ISXYXRLKM#K/J9 HAGH}FOzEVxE\wEcuEjsEqrEzpEoEmEkEiEhEfEeEeDeDeDeD@NX]^]XRPR Q,O6 }M>yKEvJLsIRqIXoH_mHfkHmjHvhHfHeIcHaH_H ^H^H]H]H]H]HES\acb^XU VV)}T3xR; tPBpOHlMNiLTgL[eLbdLi bLr!`L|"_L"]L#[L#YL$XK$VK#VK!VKWKWKWKJW`dgfc]ZZ~['yY1tW9 oU@jSFfRKcPQ`PW!^O^#\Of$ZOo%YOy&WO&UO'TO'RO'PO'OO'PO$PO"PN!PN PN N[chkkha_~_y_$u^.p\7 kZ>fYDaWI]UNZTT"WS[%USc'SSl)QSv)PS)NS)MS)KS)JS)IS(IS&IS$JR#JR"JR"S_glnolfcycud pc,kb5f`< b^B]]GY[MUZR#QXY&OX`)LWi*KWs+IX*HX*GX)FX(DX(CX'CX%CW$DW#DV#DV#Wcjpssqk{hth ohkh)gg2bf: ]e@YcFTaKP`P!L_W%I^^(G^g)E^r)D^~(C^'B^&A_%@_$?_#>^">]">\">\">\"\gotwxwqxonninen%an/]m7Yk>TjDPhIKgOGfU"De]$Bef%Aeq%@e}$?f">f!=f mewR;wZ9vd8vo7w{6w5w5w4v3v1u0s/r/q/qmv~}naSNL!I,F4B;>B ;I8P6Y4c3n2z10 / . - ,} +| *{)z)zs}zi\OD A?%=.966>3E1M /V .` -l ,x+)('%%$## # {teVI<420&./,8*@(I&R%]#h"u!{m_PC7+# !$-7@JUan} tfXJ<0%   )4>JVdsxj]OB5( &1<HVfx}n`SE8,   "-9FUg{ɐȦǿrcUH:." '4CTh~ߔߪufXJ</# ->Rgyj[M>0$ %7Md|+9HT^hqx~   '6DP[emt{  $2?LWaiqw} -;GR\elsy~'5BMW`houz  .<HR[cjqv|  '5BMV^flrx}  .< G Q Yahntz$(&'5BLT\ciou | !!!!""""!!'1550&""%0&='G(P)W)^)e)k*q*w*~***+++++++***"1;@@;4+ -/+070B1K1R1Y1`1f1l1s2z222222}2{2y2x1x1w1w1*:DHIE?668&727=7E7M7T7[7a7g7n7u}7} |8 z8 y8 w8 v8 t7 r7 q7 o7 o7 o6 o6 3BKOPMG@=?">.>8=A jJDgHJdHPbGV`G]^Ge]Gm[GwZGXGVGUGSGQGQGQGQFQFQFIV]acb^YT|SwT!rS,nR4iP; eNAaMG]LM[KSYKZWKaUKjTKtRKQK OK MK LK JK JKJJKJKJKJNZaeggc]~YwXrXnX)iW2dU9 `T?\REXQJUPPROWPO^ NOg!MOq"KO|"JO"HO"GO!FO!DO!DODNDNENENR]dikkhbz^r] m]i]&d\/`[7 \Y=WXCTVHPUNMTTJT\!HTe"FTo#ETz"DT"CT!AU @U ?U>T>S>S>R>RWahmppnhwdmbgbdb#`b-[a5W`; S^AO]GK\LHZSEZZ CZc!AZm!@Zy ?Z>[=[<[:[9Z9Y8X8X8X\flqtusnukghah]hZh)Vg2Rf9 Ne?JdEFcKCbQ@aY>abjP;jX9ja8jk7jw6j5j4j3j2j1h0g/f.e.efov{||ozaxTuOuLv!Jv+Fu3Ct:?t@ }.;}68}=5|D3|L 1|U /|^ .|i -|u ,|+{){({'z&y%x$v #u #u r{vfXK=754'10/8-@+I)Q'[&f%s$"!zqaSF8,(&$(#1!: CLVbn|xj[L?3'&09C N Zgu~pbTF8,  $.8CO]k|ugYK=0$",6BO_pzk]OA4' (3?N`sˆž~o`RD6) #/<M`vڍ٤ػrcUG8+*9LaxvgXI:,$6J`w  )8EQ[emtz   %4AMXaiqw} !/<IS]emsy~*8DOYaiouz $2?JT]dkqv{+9DOX_flrw|%2?IRZagmsx~ *8CMU\cintz  !$" #1=GOW^djpv}%.21+! +7B K R!Y!_!e!l"r"y"#####$$}$|${${#{#!/8<<70%$'&(2)=)F*N*U*[*a*g+n+t+|+~,|,{,y,x,v,t,s+r+r+q**9BEEA:2-0!0-181A1I1P1V~1\}1b{1iz1px2xw2u2s2r2p2o2m2k2j1i1i1i12@HLLIC<5 77)737<|7Dz7Kx6Rv6Xt6^s6eq6lp7t n7} l7 k7 i7 g7 f7 d7 b7 a6 a6 a6 a6 9FNQRPJC==>%|=/x<8u<@ r;G p;M n;T l;Z j;` i;h g;p f;y d; b;a;_;];[;Z;Z;Y:Y:Y:?LSVWUPJCC{D"vC,rB5nA< k@C h?I f?Od?Vb?\a?d_?l^?v\?[?Y?W?U?T?S?S>S>S=S=DPW[\ZUPJzHuIqH)lG2hE9 dD@ aCF_CL\BR[BYYB`XBiVCrUC}SCQCPCNCLBLBLBLALALAIT[_`_[U}OuM pMlM&gL/cK6_I= [HBXGHVFNTFURF]PFeOFoMGzLGJGIGGGEGEFEFEEEEFENX^cdc`ZyUpRkRgR$bQ-^P4ZN: VM@SLFPKLMKRKJZJJbHKlGKxEKDKBKAK?K?K?J?J?I?IR\bfhhe_vZkWeWaW ^V*ZV2VT8 RS>NRDKQJHPPEPXCP`BPj@Pv?P>Q=QV_^M;]U9]^8]h7^t6^5^4^3^2^1]/\.Z.Z.Y`iotvwvzrooalTiNhLiIi)Fh1Bg8?g> x9x7x5x(3x01x8.w?,wG+wP)wY(wd&wp%w}$w"w!vvusrqqrzscUH:/ ,* (*'2%:#C!L V`mz~}|{zzy|m^PB5(  )2;EOZg u ufXI;/#  )2<GS`n}{m^PA4( (2=IVeurdUG9,   &0<IXhzwhZK=0# "-:HYl{l]O@2% )6GZpӆҜҳo`RC4'  %3F[rsdUF7(  0E[r  '5BMXajqw}#1>JT^fnty~,9EPZbjpu{ '4@KV^elqv{"/;GPY`gmrw| (6AKT[bhmsx}"/;ENV]cinsy '3?HPW^diou{" -8B K R Y _ e j p w ~~~#,/,'&2=EMTZ`flsz~}{yxvvuu!.6983+!! -!8"A"I#P#V#\#b~#h}$o{$vz$x$w%u%t%r%p%n%m%l%l$l$*7?BA=6.% ')(*3*<~*D|*Kz+Ry+Xw+^u+dt+kr+rq+{o,n,l,k,i,g,e,d,c+c+c+2?FIIE?8//0$|0.y17v1@t1Gr1Mp1So1Ym1`k1gj1oh1wg1e2d2b2`2^2]2\1[1[0[09EKNOLF@8~6z7 u7*r63o6;l6Bj6Ih5Of5Ue5\c5cb6k`6t _6~ ]6 [6 Z6 X6 V6 U6 T5 T5 T5 T4 ?JPTTQLF?x;t<o<'k<0h;7e:>b:E `:K ^9Q ]9X [:_ Z:g X:p W:{ U: T;R;P:O:M:M9M9M8M8DNUXYWQL|FsA nAjB$fA-b@4^?;[>A Y>G W=M U=TT=[R>dQ>mO>xN>L>K>I>G>F>F=F=F<G<IRX\][WQyLnGhFdG!`F*\E1YD8UC> RBC PBJNAQMAXKBaJBjHBuGBECDCBC@B?B?B?A@@@@MV\`a`\WuRiLcK_K[K'XJ/TI5PH; MGA KGGHFNFFUDF^CFhAGs@G?G=GL\=Lf;Lq:L~9M8M7M5M4M3L3K3J3JU^dhjig{ap^cZXV TVQV!NV*JU1GT7DT= @SD=RJ;RR9RZ7Rd6Rp5S|4S3S2S1S0S /R.P.P-OZbhlonlyhneaaS]M\K\H\'E\.B[5>Z<;ZB 8YI 6YP4YY3Yc2Zo1Z| 0Z /Z .Z -Z ,Z *X )W (V(U_gmqttrwnll^iPeFc CcAc#>c+;b28b95a@3aG 1aO /aX .ab -bn ,b{+b)b(a'a&a%_$] #\ #\ dlrwyzyvvis[pMm?k:j8j6j'4j/1j6/j=-jE+jM)jV(j`'jl&jy$j#i"i ihgedcjrx}t}ezWxIv;t1r .r,r!*s)(s2's9%sA#sJ"sS s^sjrwrrqqpnmllqx~p`RD~6|*{"{ {{#|+|4|<|E|O|Z|f|s{ { z yxw u u txyj[L?1% # + 4 >HS`m|~}rcTE8+#,6@LXfuxj[L=0$ $,7BO]m~~o`RC5(!+6BQbtteVH9+ (4AReyxiZK<. $1ATi~͕̬|m^O@0#-@UlqaRC3$ *?Vn$2>JU_gntz -:FQ[cjpv{ )6BMW_flrw|#1=HRZbhmsx}+8CMU\cinsx} &2=GPW^dinty~+7AJRX_djotz  $/:DLSY_ejou|(3=FMTZ_ekqx~}{ z y x x "*+(#  " - 7@HOU[agm~t}|{zxvusqpooo!-464/' (2;CJ}P{Vz\xbwiuqsyrpomljhgffe)6<>=93* !#}"-{#7x#?v#Ft$Ls$Rq$Xo$_n$el$mk%ui%h%f&d&c&a&_&^&]&]%]%2=CFEA;4+~'y(v))s*2p*:n*Bl*Hj*Nh*Tg+[e+ad+ib+ra,|_,^,\,Z,Y,W,V,U+U+U*9CILKHB<4w. s/o0%k0.h06f0=d0Db0J`0P_0W]0^\0fZ0oY1yW1V1T1R1Q1O1N0N0N/N/?HNQQNHC{<r5l5i6!e6*a52_59\5@Z4FX4LW4SU4ZT5bS5kQ5v P5 N6 L6 K6 I5 H5 G5 G4 G4 G3 DLRUVSNIxCm;g:c;_;'[:/X96V9<S8BQ8H P8O N8W M9_ K9h J9s H: G: E: C: B: @9 @9 @8 @8 A7 HQVYZXSNuIiBa?]@Z@$V?,S>3O=9M=? K=E I=L G=T F=\D=eC>pA>|@>>><>;>:>9>9=:<:<LTZ]^]Y|SqNeH\E WETE!QE)MD0JC6GB< EBC CBI ABQ?BY=Bc vH vSv^vlvzuutrqponw~vgWI;.! &.7BMYfu~}{zyxx}o`QB4' '/:EQ_n~vgXI:-  '0;HVev{l]O?1$  &0=K[lqbSD5' "-;M`tufWH9* +;MbxШzk[L<- );Pf}~n_P@0 %:Rj .;GR\dkqv{*7CNX`gmsx| %3?IS[bintx} .:DNV^djoty~ (4>HQY_ejoty".9BKSZ`ejpuz(3<EMTZ`ejpu{!,6?GNTZ`ekpw~~}||  %/9AHOU[`flrz}|zxwutsrr!'(%)3;CIPV}[| az hx ow vu s r p o m k jiih ,131+$  "-}5{=yDwKuQsWr]pcokmsl|jhgecba`__*4:<:5/&~zw(t1r9p@nGlMjSiYg`fgdpcya`^\[ Y X W WW2;ACB>80(w s!o"$l"-j#5h#<f$Cd$Ib$Oa$U_$\]%d\%l[%vY&W&V&T&S&Q&P&O&O%O%9AGIHE?9{1q(l(h) e))b)1`*8^*?\*EZ*KY*RW*YV+`T+iS+sQ+~P,N,L,K,I,H+H+H*H*>FLNNKE@w9l1e.a/^/%[/-X/4V/;T/AR/GQ/NO/UN/]M0fK0pJ0|H1G1E1C1A0A0A/A/A.BKPRSPK~Ft?i8`4 [4X5"U4*R40O37M3=K3CJ3JH3RG4ZE4cD4mB5yA5 ?5 =5 <5 :5 :5 :4 :3 :3 GOTWWUP{KpFe?[:V9R:O9'L9-I84F7:E8@C8GA8O @8W >9` =9k ;9w 9: 8: 7: 5: 4: 39 38 48 47 KSX[[ZVyPnLaFV@P>M?J?$G>+D>1A=7?=>==E ;=L 9=U 7>^ 6>i 5>u 3? 2? 1? 0? .?.> -= -< .< OW\_`^[vVkQ_MSGJD GDDD!AD(>D/J;J&9J-6J34J:1IA0II.JQ-J[,Jf*Ks)K(K'K&K$K#J"H"G"F X_dhihfsbh_\\OWAR9Q7Q5Q#3Q*0Q1.Q8,P?*PG)QP'QZ&Qe%Qq#R"R!R QQPONM]dimnn~mqiggYcL_=[2X /X-X+X')X.'X5%X=$XE"XN!XXXcYpY~XXXWVUTSbiortt}sqpcmVjHf:c-`%_#_"_" _*`1`9`B`K`U```m`{`__ ^ ][ZZhouxz{|znw_tQqDn5l(jh hhh$h,h4h=hG hQ h\ hihwggfedcbaov{xj}ZzLx>v0t#sr q qqq&q/q8qBqLqXqdpspoonljiiv}sdTF7~*}|{{{{{!{){1{;zG{R{_znz~yxwutsr~zl]N?1$  ")3?KXgx}}sdUF6) !*5BO^oxiZK<-  *6DTex~o_PA1# )7GYlsdTE5' %4H^twhXI8) #4J`xّبֽ{k\M<, "5Ld|+8DOX`gmsx} '4@JT\cioty~"/;EOW_ekpuz*6@JRZ`fkpu{ $0:DMT[afkqv{*5>FNU[afkpv| $.8@HOU[`fkqw~(1:BIOU[`fkry}|zyyww !+4<CJPU[ag}m{uz}xvtrqpnmll $%!%.6~>|D{JyPxVv\tbriqqoymljhgedcbb!*/0-(  }z(w1t 8r ?q Eo Km Ql Wj ^h eg me wcb`^][ZYYY)27972+#x tp"m+k3i:gAeGdMbS`Z_a]j\sZ~YWVTRRQQP1:?@?:4-{$qlhe'c/a6_=]C\IZPXVW^UgTqR|Q O N L K J I I I7?DFEA<5v.l%d!a!^"#[#+Y#2W#9U#?T$FR$LQ$SO%[N%dL%nK&yI&H&F&D&C&B&A&A%A$=DIKKHB|=s5h._( Z(W(T)'R)/P)5N)<L)BK)HI)PH*XF*aE+kC+vB+@,>,=,;+:+:+:*:)AINPOMHzCo=e5Y/T-Q.N.$K.+I.1G.8E.>C.EB.M@/U?/^=/h<0t:090705040303/3/4.EMRTTRNxHmCa<V6N3K3H3!E3(B3.?24>2;<3B;3J93R84[64f55r352515/5.5-5-4-3-2JQVXXWSuNjI^CS=I9 E8B9?8%<8,:8288868@48G39P19Y09d/:p.:~,:+;*:(:':'9'8'7NUZ\][XsSgO\JQED?>><>9>"7>)4>02>60>>/>E->N,?X+?b)@o(@|'@&@$@#@"@!>!=!<RY^aa`}^qXfU[ROMAG8E 5D3E 1E'/E.-E4+E<)ED'EL&EV%Fa$Fm"F{!F FFFEDCBW^cfff|dp_e]ZYMT?O2K .K,K*K$(L+&L2$L:#LB!LJ LTL_MlMzMMLLKJIH\chkll{jofddW`I\;W.T&R$R"R S(S/S7S?SHSRS]SiSwSSS R QPONahmprrzqnnakSgEc7`*]Z ZZZ#Z+Z3Z;ZEZO [Z [f ZtZZYYWWVUgnsvxxzxkt]qOnAk3h&fdc c c c&c.c7c@cKcVcbbpbba`_]\\ntz}v}gzWwIu;s-q ommlll!l)l1l;lFlQl^klk{jihgfddu|~paQ~C|4{'yxwww vvv#v+v5v@uLuYugtvtsrqonn}xiZK;. $-8ER`q~}|zyxpICC_PROFILE aRB3& $.;IXh{vgWH8* $/>M^q{l\M=.#0ARezpaQA1# !0DXnueVF5%.D]vҍңѸyiZJ9) 0G_x (5@KT\cjouz~$0<FPX_fkquz,6AKS[aglqv{ &2<ENU\bglqw| ,6?HPV\bglqw}&0:BJPV\aflqw~ !*3<CJPV[aflry~~%-6=DJPV[agmt|}|zxvutssr'/7>EK~P|V{[yaxhvotxrpnmkjihgf!"  !~*{1y9w?uEsKqQpWn]mckkitg~edb`_^]\\ (,-*$|wt$q,n3l:j@iFgLeRdXb_`g_p]{[ZXVUT S S R (0564.' {s nj g &d .b 5` ;_ A]H\NZTX\WdUnTyRPOMLKJJJ08<=<71*v"me a^!\)Z0X7V=UDSJQQPXNaMkKvJHGEDCBBB6>BDB>9{2r+h#^ZWT%R-P3N9M@KFJMHUG^EhD sB A!?!>!%e<%q;&~9&8&6&4&3&3&3%3$@GKMLJEv@l:a3U,M' I'F'D(%A(,?(2=(8<(@;)G:)P8*Y7*c5+o3+|2+1+/+-+,+,*-*-)DKPRQO~KtFi@^:R3H.C-@-=-":-(8,/6-55-=4.D3.M1/V0/a.0m-0z,0*1)1'0&0&/&/'.HOTVVT|PrKgF[@P;D5<2937352&22,133/3:.3B,4K+4T*5_(5k'5x&6$6#6"6 6 5 3 3MSXZZY{UpPdLZHNCB=79 3818/9$-9*+91)98(9@&:I%:R$:]";i!;w ;;;;;:98QW\^_^z[nVcSXOMK@E2@-?+?)?!'?(%?/#@6"@> @G@Q@[AhAuAAAA@?>=V\acdcyam]bZXWKR=M0H&E #E!F F%F,F4F<GEGNGYGeGsGGG F F EDC[afhiixgldbbU^GY9U,QMMMM!M)M0M8MBNL NW Nc NqNNMMLKJJ`fknooxnlk_hQdC`5](YVU U U U% U-U5U>UIUTU`UmU|UTSRQQPflqtvvwuirZnLk>h0e#b` ^^^^!^)^1^:^E^P]\]j]y\\[ZYWWmsx{}}s{dxUuGr8o*mkihh hgg$g,g5g@gKfXfeeueddba`_tz|n^~O{@y1w$ut ssrrrqq&q.q:pFpRp`pponmlkih|vgWH8*~}}}}| ||| |'|2{?{L{Z{jz{yxwvut|n^O?0" (5DRbutdUE5& )8GXjyiZJ:+  *:L_s}n^N>.+>Rg~rcSC2! +BYp͇͞ʹvgWG6%*B]x%1<GPY`flqv{!-7BLT\bhmrw|(2=GOW]chmrx} ".7AJQX^chmsx~(2;CKRX]chmrx ",5=ELRW\bgmsy&/7>EKQV\agmt|~}{zyyy !)19?EKQV\a}h|ozwxvtrqonmmm $+3}:{@zFxKvQuVs\qcpjnrl|jigedcbaa |x&u-s4q;oAmFkLjQhWf^efcnax_^\ZYXWVV&**& }w rn k(h/f5d;cAaG_M^S\ZZaXkWuUSRPONMLL'.231+$vn hda"^)\0Z6Y<WBUHTORVP^O gM rL ~J H G E D C C C .6:;94.z'qh_ [ X U $S +Q1O7N>LDKKISG[FeDpC|A?><;;;;5<@A?;6w/m(c ZS OM K'I-G3E:D@BHAO?X>b<m;z97643333:AEFEB~<u7k/`)U!L HFC#A)?0=6<=;D9M8V6`5 k3 x2!0!/!- + , ,,?EIKJG|Br=h7]0R)G"A!>!M9B36.1,/,-- +-')--'.4&.<%.E$/O"/Y!0e 0s111000/.LRVWXVxSlNbJWELA@;36+3 (3'3%3$#3+!42 4:4C5M5X5c6q66665543PVZ\\[wXkTaQVMKI?C1>%: "9 99":):0:8;A;K;U;bAH AS B_ BmB|BAAA@?>Y_dfggueia`_S[EV7R*NJG G H H# H*H2H;HEHPI\IjIyIHGGFED_eilmmulii]fOaA]3Z%VS PPPPP'P/P8PBPNPYPgPvPONMLKKekort~tusfoXlJhM\n~}}|qbRB2# #1BRdzvgWG6' #4FXm{l\K:*  %8K`wp`P?.'<RjȂșȱteUD2"&@[s!-8CMU]chnsw})3>HPX^dinsx~ $/9CKRY_dioty*3<EMSY_dintz$.6?FMSY^chnt{ (18@GMRX]bhnu}"+3:@FLQW\bhow}{ywvttss %-4;@F~L|Q{Wy\wcvjtrr{pnmkihggg    }'z.x5v;tArFqLoQmWl]jehmfwdba_]\\[[{vs"o)m/k6i<gAeGdLbR`Y^`]i[sY~WVTSQQQP$''# xq lhe$b*`0^6]<[BYHWNVUT\ReQoOzMKJHHGFF&-00-(!zric _[X%V+T1S7Q=OCNILPJXHaGlExCA@?=<<<-47861+v$md[ UROM&K,I2G8F?D EB MA U? _= j; v: 8 6 5 3 2 3 3 4:>><8}3s,i%_VMI F D!A'@.>4<:;B9I7R6\4g3t1/.,**+,9?CDB?z:q4g-\&RHA >;9$7*60473>1G0P/Z-e,r*(&%##$$>CGHGEx@o:d4Z.O'D ; 642 0&.--4,<*D)M(X&c% p# !     BHKMLJwEm@b;X5L/A)6#0! -!+!(!#'!*&"1%"9##B"$K!$V %a%n&}&%%%%$$FLPQQNvKkF`AV<K6@14,*' &&$'"' !''(/(6)?)I*T*_+m+{+++***)JPTUUTuPiK_GUCJ??:35&/ ---.%.,.4/=/G/R0]0k1z 1 0 00/ / .NTXZZ~YtVhQ^NTKIG=B0<#74 344"4*515: 5D 5O 6[6h7w7666543SY]__}^s\gX^VTRHN:H-C?;: ; ; ;'GNU[`ejou{%/8@HOUZ_ejou|  )2:BHNTY^diov~$,4;BHMSX]cipx}|{z{ &.5<AGMRW]~c}j{ry{wusrponmm!(/}6|<zAxGwLuRsWr^penmlvjhgecbaa`  {x$u)r0p6n<lAkGiLgRfXd`bh`q^|\[YWVUUU {v qmj%g*e1c7a<_B^H\MZTX[VcUmSxQONLKJJJ"%$ { slgc_ ]&Z,X1W7U=SCRIPONWL_JiIuGECBA@@@$+..*%vm e^ YVS!P'N,M2K8I>HDFKDSB\@f>r=;987655,2553.{(r!i_WP LIG!E'C-A3?9>@<G:O8Y6c4p3}1/.-,++38;<:5y0o)e"[RI B @=;#9)7/6 54 <2 D0 L/ V- a+ n) |'%$ " !"# 8=AA@<w7m1c*Y$NE;6 410$.*,1+8)A(J&T%_#l!z<BEFEBu=k8a1V+K%A70 ,*( &'$.#5">!GR]jy@FIJJ~GtCi>_8U2I-?'4"*%" #+3;EP[h w    EJNON}LsHhC]?S:H4=03+(%! !!!!"("0#9#C#N$Y%g %u & %%%$$ #INRSS|QrNfI\ERAH==823&.( ''((&). )6 )@ *K*W+d+s,++**))MRVWX{VqSeO\LRIHE<@/:"50. . //$0,040>0I1U1b2q21100/.RWZ\]z\pZeV[SRPFL8F+A=85 667"7*727<7G7S7`8n8~876544W\`bczbp`e]\[PWBR4M'HD A> >>>?'?0?9>D>P>]?l?|>=<;;:\behiyipgeeYaK]=X/T!PLIHGGGG$G,F6FBFNF[FiFyFECBA@chlnpyppobkTgFc7_)[XUSRQ QPP!O)O3O>OKNXNfNvNMKIHGioruwzwlt]pNm?i1f"ca^]\[ [ZYY$Y.X:XFXTWcWsVUTRPOqvz|~u|fyWvGs8p)mk ihgffe ddcc(c4bAbOa^`o`^]\[Yy~}o_~O|?y/w!usrrqqppo onnn,m:mImXlij|ihgfevfVF5&} |{{|{{{zz zzz"y1yAyQybxuvusrq{m]M<, %7GYmrbRA0  ';MayvgWF4$ ,@Tk{k[K9( 0F^v~o`P>, 6Oh܀ܘܮ %0<EMU[afkqv|!+6@HOV\bglqv|'0:BJPV\afkqw~ !+3<CJPU[`ekqx%-5=DJOTY_ekry  (/6=CINSX^eks|}{yxvuuu")07=BH}M|RzXy^wfumswqpnljihgg }$z*x1v7t=sBqGoMnRlYj`hhfqd|ba_]\[ZZ zvr o%l+j2h7g=eBcHbM`T^[\cZlXwVUSQPONN }vq lhd!a&_,]2[8Z=XCVITORVQ^OgMsKIGFDDCC "!wnhb ^ZW"T'R,Q2O8M>LDJJHRFZDdBo@|?=;:999#)++'!{ri `YTPMJ"H(F-E3C9A??F=M;V9`7l6y531100/+0330+w%ne[SLGDA>#=);.947;5B3J1S/^.j,w+)'&&%$179973u-l&b WNE > :753$1*/0.7,>*G(P&[$g#u!7<??=}:s4i._(U!KA8 0 -+) ' %% +$ 3" ; D N Y ft   ;@CDB|@r:h5^/S)H#>4+$ ! (/8ALWdr      ?DGHG{Eq@f;\6R0G+<%2 )%,5?I U b pCHKLLyJpFeA[<P7F2;.1)'$ " * 3 =GS ` n!~ GMPQPxOoLdGZCP?F;;612%,&" "## $($1%;%E%Q%^&l'|'&%$##LQTUVxTnQcMYJPGFC;: :::":*:3:>9J9W:f:v:97655[`dfgwfmeccW_IZ;V-RMIFDC CCBB'B0B<AHAUAcAsA@>=<;afjlnwnnl`hReD`5\'YU RONM LLKK$J-J8JEIRI`IqIHGECBhmqsuxujr[nLj=f.c `][YXWV VUTT(T4SASNR]RmQQPMLJptx{|szdwTsEp5m'jh fdcbba` `_^"^.^;]I]X\i[{ZYXVTw|{l]|My- !6I]steTC2!%:OexiYH6%*AXp|m^N;)0Ib{֓֫",7AIQW]chmrx~'1;DKRX]bgmrx #+5>ELRW\aglry &.7?EKQV[afls{!)18?EJPUZ`fmu~~}| #+28>DINTY`g}o|xzxvtrqpoo%+2}8{=zCxHwNuSsZqapinrl}jhfdcbaa {xu&r,p2o8m=kBjHhNfTd[bc`l^w][YWVUTTzu qmi!g'd-c3a8_>^C\IZOXVV^TgRrPOMKIHHH xqkgb_\#Y'W-V3T8R>PDOJMQKYIbGmEzCA@>=== { rjc] XUQN#M(K-I3G8F?DEBM@U=^;j:w8653322"')($wne\UP KHDB#@(?-=3;:9A7H5Q3[1f/t.-+**))).10-}(t!jaW OGC >;86$5)3/15/=-D+N)X'd&q$"!05774{0r*h$^TJA:5 2/-+%)+'1%9#A!KUbo~5:<<;z7p1f+\&RG>4 ,(%#! &-5>HS_m}     9>AA@x=n8e2[,P'E!;2)    " * 2 ; F Q ^l{  =BEFEwCm>c9Y4O.D):$0'   ' /9CO\jyBGIJIvHmDb?X:N5D09,0('#  %-7AMZhxFKMONvMlIaEWAN=D9:511%,%  #+ 5 @ K X!f!v"!JORS~SuRkO`KWHNEEA;=-7 2,'& %&&!&)'2'=&I'V'd't('%$##OTVX}YuXkU`RWOOMDH6C)=83/. ---.'.0.;-G-T.b.r.-,*))TY\^}^t^k\`YXWMS?N1I#D? ;86 6555%6-595E4R4`5p54210/Z^bd}eudkcaaU]HX9S+OKFC@?? >=="=*=6=gloq}svshpYlJh;d,`]ZXUTSRR QPO"O.O;NINWMhMzMKJGEnsvy}zqxbuRqBn3j$geca`_^]\[ ZZY(Y5XDXSWdVvVUSQPv{~yj|ZyJw9t*qo mlkjiihgffee d.d=cMc^aq`_^][qbRA}0z ywvuuttssrrqqqq$p5pEoWojmkjihwhXG6%~~~}}}~ ~})}<}N}a|wzywv|n]M;*  1DWmrbRA/ 5Ja{vgWF3!%;Rjzk[K9&+D\vяѧ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~ozPMXэiJqѼËn? vCC[!6xqP?+ˠy=Yĝ¯ԎP3[݋C,Z mt)OG7}G> ʃDpНh<43Hg̦ڴkA.#]b2s)~Cak I04}6z] fs0M^*.͕gSN^uķoQ@2#`׋F 7G_ q)YhE$1=_k"Qk+3r7kYT]ky鲏vdUD3xz;Bt'5TnYfG"4UcBF*-ݢc9.ѫ~˴~mbĄT4 `df9'O_cP#@-Tz)q k̿wW=&$/;GTs紐s[E1eb'5Pap"GO!l&lN2 'i < ӿxia`gpzʲt_GAʊ[8NjKTnhzղ}qib^YURNKJLPV_j6dE2*b >d,ZT23*C^|/=O`pŽl\OE=5.)$"*7>t/X~Cm$W#* $@^}t 0@Qf}Ռӷ~yuroppsxJ8*! Frn7Z]J:7&d )K..Mlk  1F]vagzrib\WRMJHGGILS^o]',T|+QxAb= +Kno3JcMCWk~ɻcVLE>950,*('(,29JhFt#Jp,4\S4U{},C]}R.BVj~}zyz{B91*%"(Hr@k'.M-S{q"Fl8/Gba"7Lbv||tnjhggigkqx/! 2^I1]p'Rz58_V${D#2k~W: .DtU@矯{^>d|߽u.5:[xOF|P<}xu=qO|̔-l̥buK[{^L?%*hO |A.z7Wy>{n?.7SsQ6jRmUVۗ [~ 8{ TNMOY5Y:{/_{{bOwFG~uC#R"E-~᤬R[AUO[EUOKWIASB:Gg@m4^o~ vզ \^̨-X}B:J)B߽uE ]ڲ?w|S zwxK5T4M JG1 >$-mkL~;_#Ч7׺R:lWȝZ =Ep>4Ҕ{yRgshAFT߽uQ}_Ngi+LlNܸN^od2P )}ߺE+߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽t5'O}XjO|P}]Fگ7{^Sz=ݝ)w^\q#ܻQSsc׺>|gK7Av$>8u^]zZ޴O7GO ǽuv??e_ ;6ȯ9yLb)ٸ4z͘Ûj9-tu@uOiZ?+Iп6{}U­?X{Nɪ]`v>cbqUXݬ׺-V!S:G)u׼DY,~3 gEPxo U>J%o' ={x>J;?Ͳw'fLJI A_z,>$SEt1gf{uy窞jI*'ys$M4;1,ĒM>{^{{u׺{^{{u׺{^{{u׺{^{{u׺{^{{u׺{^{{u׺{^{{u׺{^{{ugw¾!~9| ffc 7-zm i_61.BAu 5bY;_7V+0c/:l;&:ͷf:l׺,\/zP']Uኦ'^Z^#9-C 3_{^cUFlޠM5VC;lo_~[7Iz :^(F+q׺}ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u^~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~o}ݽ׽C 巶.֡: *s]T2kp ~k;':Sn$]7}bbuDu\5.Gw0$lmd6׺K+l&_ߧ.>kޟ+}di0-^ m un?{m׽'=>Τs8wnb,jUP׺ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺJw\nLfv*pfn ܘT߽uWTq/ bPxmkf20}ߺF߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{^~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~RoΟPg? ^f8ژvH= 8{^MϛsWwU?{:MI"Qw7uM1E]K>ेk̨K=1$:uug~zM${;zJf;zg}^> HX"ttQjR5U{ߺ@o{^{{u׺{^{{u׺{^{{u׺{^{{u׺{^{{u׺{^{{u׺{^{{u׺{^{{u׺{^{{u׺{^{{u׺{^{{u]oӛ=E[w _6{uوLŶ禫 >{ºgƿg4['\Px)Nǁ6/p)񝷳isQpmyߺ[C+/ψ0S6%;ǰI#۽G,fhLӌn6rF nu7%r|WPWc5q khkiY)Q6*A׺׺{^{{u׺{^{{u׺{^{{u׺{^{{u׺{^{{u׺{^{{u׺{^{{u׺{^{{u׺{^{{u׺{^{{u׺{^{{u׺{^{{u׺{^{{u׺{^{{u׺{^{{u׺^~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽t݅hg{띇(%7x}>2[?5=%,@ ̫r}ߺZ0/XoGíqDjμ=z^]阥|scbMR"p{#~z??q;g}wy<2tWBwVꋉ1[12w9&Ǘ0 {g~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~Y^N.ޛ[fWYӦϒ_-ju8Y.Vl.:JERu` :la3* =Wu>k:v& ƣtLfI~n%?":#_;WoutZIub7^!*|k$܄ةdjJCX!k#׺}ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u^~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺAqoO|yjgNm5taۡgV0S>S5,1=DJSFZY;׺/:[NwW7{nMMvORcZh[>]2dF,uq}{>h1w{[|]VU]s06wYԥcDT̠}=ߺD߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~>ͯw^oYV 15̽[ dr!p}ߺVԿwI_]u nGܽ?:mU)GbAHҨ׺N9Jiw/QuJSؕoSMSJ k~Յ"3T@{͉)q;?f{ϰ]'`]lT&譥z7[o~?W2n^*WI-=WJz4ccF5cW{^mOIK۩:dT?vѼ6>o {on?F |v~׷UUߺB3'F]'cIS-~.?_M-nQz][^[+5{~Ӽ?S‚4[?A$)Cno,Fc>{A-߄ ?o) 5&)q׺H̖5˫:`䷤a_ſ߽tg;cqF>-: wޙvzpG{^ ܟy/ͧ4QE|n*l쯁mUOO{^G_yנmu _7߽tQ7"'NDMkŁsWZvHd6{SoR~_CwRv_U4$[k= G߽u_]oTҏt$Aڞ>5MRQ}$XidzuZ?gK}_Y)5'"ҜU:Τ$[߽uYݷӹo=սՙNdnmifF=ߺAϿ{^{{u׺{^{{u׺{^{{u׺{^{{u׺0>Y|y4ݥ37%n,%4h[ 3gij)߽ufzuSǟ}̠O:bX* bVWmmi׺̿_6[KWV͗ەQyM^euPTOtf}ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^^~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽tMwb]q6>\pv۸HWvX))iT\{=ߺZc3OXFunjOȡ:7V6~V<I`!XߺZ|`e|mf|/5]ٴDy6&%6 DPe#\$u{^{{u׺{^{{u׺{^{{u׺{^_<?>{!AQпA &PDq)+ܣA=q!Hf u#BQd~<|ks* IqxQq{u?gV=+T76OGtG |.?՟{^:Khj_H#i2]w?|K[PZwpd3T y1G@q׺8Gwո;+ml8XQ4԰4q~{{u׺{^{{u׺{^{{u׺{^{{u׺{^{{u׺eonMVu`p\:.q5dc:~iNS_!ү'|%nCk`譒O=^Jen{^;{WWt+-/=쭏Fʊ/ck3Sp.{ߺT7i}wƏty&sytn詋J:%Í጖qRFܱ1{!Ń]U_= IzkAhP)W[hi-[Ȩx~TWdpfC IIehq* ihj%E<2:?#߽t׺{^{{u׺{^{{u׺{^{{u׺}|V|Onqݓ:ho_n˿@F~MR'UHYңֽV΅dL +EmA{[Dol7'il[.ؘI&H0l8u/a} ]_yuݓG&*Z~h"l[.D|*<30"*=L}{[~Njgñ B$1\XOO,A1TĭfGe {^(~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~ո,aYn:h+v^Oo͗!=kV1dI0s#x{W|i4ΞE-6Ohfqu嬗z=Ld &n:{m`~n*h1ǻ{'<{/+O'>m׺8{{u׺{^{{u׺{^{{u׺{^{{u׺{^{{u׺{^{{u׺{^{{u׺{^{{u׺{^{{u׺{^{{u׺{^{O~6GoLuwlJ+ٻ;ԕ2#\2b UoVEe{ߺZ|g@gw|VSNޒWe*tRG'U&O.Q~ic2&_1F;Il_O*?H7>O#M:qAN{^i}6immC/&UMaQMMkp{~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~ #X)Q$DhElAu`|VU_xe{KE &c5eE=%Fב߽u2_khGqb?Ba {\fJƯ=LPSĺ箏={r%X% Q)cmG$obA׺׺{^{{u׺{^{{u׺='.ɨz 9}a{cM*S ȚA$CWK+=ߺ_Oo '>u>a 4#ћ7 %nS}X312NY,2b׺[߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u^~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽uI#7WHI$Gh5; ~{,_*~9I>4->!*RnN|-M'^St9Nu7ݒZYaR~|;k{G{vvtorn٪ewj¶"$Du׺{^{{u׺{^{{u׺w5n.:ע+j#ߑKf t˲ՠ'dE\ E:L*@ǽu[oV,̿϶~ws>L#Rjzܙje_%=\={(""!"c(PhUPUp=ߺY=ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~RAˣ7iu4=[ޙX>DtX5U\VBs+1R={,01n\ 5]37a|4v'K,qQY+CJe@ue*J*J ~{u~{߽u~׽ߺ^~{߽u~׽ߺS1!Ab\3'!QN4U̲C42*d`H ~cz;``vw)j]]4t鉡I*w &wONrm+ߺ_B?i͵ؽi;G6٬v Eg12KMSK {׺Vu׺{^{{u׺{^{{u׺{^{{u׺{^{{u׺{^{{u׺{^{{u׺{^{{u׺{^{{u׺{^{{u׺{^{{u׺{^{{u׺{^^~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~ D>#Su>Ơ5xﴡcS]PchafXiWT>kš{O:Ou|~c+aSGTq X<bEP))={U=ߺ^~{߽u~׽ߺ^~{߽u~׽ߺVZ|f;o62 -7ׂ`[S$&.*SF m~}?%G_h||w/4kv/ǭ}a\e=, Z?<2xqt3/Դ444tTt=---w!!]~>CXc\ťo {2VEG)^f1QV/׺~׽ߺ^~{߽u~׽ߺ^~{߽u~(/LoJ|6٭9?1SU(#z2;m-̓%%g׺/AGtvZ7 8{4W؛Ie&%%Ր5bQUTĥǽt{ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{^~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺU?/YҒȝjFvn]=Wgv~0^ngufxS7XRJ={Mo?,o~{pvl+_~>J^E-#+hJJ%{^=ߺ^~{߽u~׽ߺ^~{߽u~Г]9{gzKkvf\no.UObOHZZY]#Fa~ot5 2Req4xFU~~JψڵƬgF{ߺ[gSGl-՝7;zg&3kmq{[k`P0㰸h=nZI\&ܳ1u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺH잿퇻;GwιظJǼce3|0B$~Cڴ{릻7kdmì{^$?j$:H6IO~Ѕ׺{^{{u׺{^{{u׺{^{{u׺{^{{u׺{^{{u׺{^{{u׺{^{{u׺{^{{u׺{^{{u׺{^{{u׺F^+Qx̍,>Vhf9bJ${uk?(?o|LJϻVueE-_-[$0aQU%b OQP;ԏ{^wG/_=}RyǜJ0MbnkMYU4jB#ƾX~{߽u~׽ߺ^~{߽u~׽ߺFO;n|y, jϵo[oI:OٻlKUGTKs ߺ_U~86-G̽5{ӢYK}yM9l 2*b'#uH{{u׺{^{{u׺{^{{u׺{^{{u׺{^{{u׺{^{{u׺{^{{u׺{^{{u׺{^{{u׺{^{{u׺{^{{u׺{^{{^~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~ֿt[ m s|ݘO=#Ei2݃ݕYH Ni o{^5Oݻ>C|gv}[-*Ŏb m] IQ h1G z$׺.{{u׺{^mmMӼ6~Er~.9enH>{#w7ZG٨0EưEWl{^t=EAU.x4ʜFgPP>u{6s_o'rQKq=5Ԩܔxsݡ H*T{u?n{?z: ZoYlEvUomY_A~l_剰%_z CMwKK;.%Ox WQ$Xld$Q7ub{{u׺{^{{u׺{^{{u׺{^{{u׺{^G_YG3?{3㻟c]Is[>㣛)"Xn U^{^T;硻[yߛZBmUK;roSr ~YL];)p>7؛G x^17~!VsˈɉV o{^b~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺEß8z+_*:h^e >O3nZ("z5L߽uc[_k_+C'c@ ?{ul/azMJ.eǹiwƌ~JZF~Տuw$,u۾#**}%vۢ1{u鿷}~&VRh4}/ VO.RԆ?}ߺGil}qiػCk,ztb6ZhSEb '{G{^{{u׺{^{{u׺{^{{u׺{^{{u׺{^{{u׺DvgclΞ=;7so+إil4ۃpE=%<a׺1_z,ݳ߬L3Ѧ]61 js1>˿,F`_1a}Ev?i|+׸qkjŗɮ {^鈪TUUTX~~{{u׺{^{{u׺{^{{u׺{^{{u׺{^{{u׺{^{{u׺{^{{u׺{^{{u׺{^{{u׺{^{{u׺{^{{u׺{^Z/ ɢܽ :ϷrLtlBj۟&%\YUuud5|^ɑU}9@lu[!*Jy<90UOR@@~{߽u~׽ߺ^~{߽u~j̬IVRYI }~o BV)6?oefm'8.wU{ϑڇE? 3dN0 ӹ\KJ_E~} iii( *ZicxİTS*C# 6~g~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u^~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽ubazlV:O-EE\c)衒C5USLIȻrI~N~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~M}_%zxtw}[mnK5X*SIR=4?qN'hgY!H׺,]Ja7FүtYn<+$0KH]jizh;#9 u&)/ǿ{^i+ҟ0:Cb|cNlfq&L.rVm}?'Lbcuq='N uO~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~1|CglLѵYS݁a!*_"uIa׺:N_Y~|υIv)_~t-Lh=ᷱ),Eb\t#<~kk׺{^{{u׺{^{{u”7/ Fo5{{j3[GJ)Y2<9= USD%EO{^靷w`0jfln\N?=w#GgyzDf0l{U-L$"21R{^߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u^~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽tv_Nx^ç8O}$1ŧW5ܛ[߽t/+VpAP}ߺT¿5ٛOEO;[ڹ}F\Ҧ5Y04ε4 #Fb(>v.1qJ]٨:d{Gv^z6n%%K׺0OgXOEUq][OjzqN׺C;tq\bu;;_ëWM#l{^{G1OgmCUKõ2qc a*,{u.G%Vd ܦFC5^C#U=umT-E]K4S1>{^{$+pK ǣAWAQH/A-O߽u{^{{u׺{^{{u׺{^{{u׺{^{{u׺{^{{u׺{^{{u׺{^{{u׺{^{{u׺{^{{u׺{^{{u׺{^{{u׺cNZ)QX܍45>Vhf9bJ${u:xLfw|V;Z Wb6xyuU?䝖:uH>g҂ɈҟQ~|s,6ev:&oq՘3j,#1$sUSL F#`G{^߽u~׽ߺ^~{߽u~׽ߺ[[|Dvn-Ok9 LU^Rii[~gf!CPjh^ԃhnWno{e /rM׶y6j28/y D vGF ׺Q{u׺{^{{u׺{^{{u׺{^{{u׺{^{{u׺{^{{u׺{^{{u׺{^{{u׺{^{{u׺{^{{u׺{^{{^~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~(~4t ӷȎ[S-iK]z ?:ZM{/Pa]3.=uu#9 j<h Ͽ{^;K9v7Cp*;C$# QU[UgC#}ߺU_}M4)cPqI/͵#=N{_-򫘎ꏿ{^{K˷WJ|Gz C}c߻+nx1a =ߺU_O_ڿso<ϬG޳޽@Sg*py`Ty~ ij*%zyfiYF$3IbnO߽uI)_/j~0t7aUL_[ؼzLO>DyPy<׺տiuS=s50tgvmi_5hן{^B~ғkl߾rNܛ55X}n JxO{^uo{iuii3YޒnU+sLn=Ԑ?${u(ΧL* oiwV ?Jg\w|6-"?}=ߺV?տn#KT'\mʪenJ͍G,or=^{D?ŌG ;_]ub?_۝V{^fO~6*'񎿴2G|mS{vf*dzlO_O&'Y)1$pR">{~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u'He۝'bjMcJ"^ye}[+В}$0'u3~w6KwUvȬ|4E$ƒ=R<]j)'A<╅ߺ@'{^{{u׺{^{{u…7_ݘO)sYcyg|xܜwbY{j'jSua|y;~Źr[rl,) GQ  du,_Oعj:di+$+RqU>XdROI߽uٻv޸9<]{52,>KCǿ{^ YT >52Vgϴ .(s~u~{߽u~׽ߺV5D3o{_ooG}l-J+}U6Ǚژd͍VSy)=JU׺~9vMӝ'F|lj=z:M2B~XV!Q_u}vK<ł_=ߺ[7'ؕ}::k[Jq5S6*gېVAM$Tm\{ߺZҺz/)iUjVOkYlVIÎF&-7}{{^{ H~KEF2i;ˮ7 U=<USya< $>4N}ߺ[u׺{^{{u׺{^{{u׺{^{{u׺{^{{u׺{^{{u׺{^{{u׺{^{{u׺{^{{u׺{^{{u׺{^{{u׺{^{{u׺{^{{u׺{^{j3dG ^!/LwRKY_'FepURs, Gz~Z׆߹IupXu7oO~Qd+o_Yq.5;OMԟ12/ 0%'׺ߛZɽv஝LZfSZZv >{C>Wr=GSzJz޺.UPD*e+ak~|PK7m[XN!euE?0^8d5%^f$p{Ro8 {wCnދnAn;uE[PSTR[O_zoD3J={~|?q]Ӻi|XKxmmٵ)A̰{{ߺZ{u?7_}%Od>%5V[SUnM66s8ڦa$ǿ{^<]G~-v̽O0Vݣ_p6ܱ騿})\:M$h7u+0o7o|Y5Phiis_Wak~J ?u,C>zߋ9R1{K358 cX@ ߺT X_ >/-/zS3{;Np^;xzMɻia%_yzLAʩ]ˀ~|ߺ_]Jh5GdzuwWd/;{/0qY|*?*Ͽ{^b~׽ߺ^~P)ҧOKOL*2ս}'0}R,'ŬAu>>{_"_ orT럔8 ڞ[AcjW"YI~n׺{^{{u׺{^{{u׺{^{{u׺{^{{u׺{^{{u׺{^{{u׺{^{{u׺{^{{u׺{^{{u׺{^{{u׺{^{{u׺{^{{u׺{^{{u׺&;>kc>:|n_s_oC:wL[H|~R6&IO{^ݿ!fv]<~B^I{LcSa-%NK 4GYji'>E{u׺{^{{u׺{^wOL(=)GǢwWtӥ;7ZJg}8iSF&U|Wu~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u^~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~pXI!yeWX8[#I$~qScOvUu../&? K#)_X`y#߽u\= Ia4^S'{OM\+܋ e?Ͽ{^{G6uG?}[upb:aڞg Lؔ#I~Wh{ZCvRKܛOQڛ{mx>-t߽tNrUZcO*K*/aUbHj;?գX~ш[|FJ|Y2"W7Lq3JQȷa F,`?k=V[[~eG[D=bܵߥsPUa7ڌ4uhե||HW׺?~׽ߺ^~|OWxA>tyWL&ڵoݛ?-#qXjm.5gjV׺3߽t}~#+ /Con} (WS!O''i{qjbo($O({_:PMSAVP9ʫXj-_+-~9U];$y2==>4OXb-ݼ%@6upmY-Y/En en5JL+$qxX~G{^ wEݽ tZ2HϫPm$Q~_G{^PZW{?GOvM-?~\lk*4j}zsmoߺ_/~_+|ISU;յ3j==\]4ÏTqF?׺߽u~׽ߺT# pe}Wa,_q56 )ɥƫ׺u?9gNQ柮>RȢg%.3TjVH魤?R}ߺ[u׺{^1~M~muS}_bQQhfRSHkM<}J8>{{^nI'{+n)}GfwØݝe4ݱG_W5SQZqSR6?~mE_Or6dw>սqti;vP~>{/[W+$; <-GR5~}ߺU_𶟛$|^fְ˿] Tn>)i~1ǿ{^{K];#a|I㺷zLmJlgr׫}}ߺ[`>jwGO?b۝>EYn tMMH#0SӢF-ߺ[u׺{^{{u׺{^{{u׺{^{{u׺{^{{u׺{^{{u׺{^{{u׺{^{{u׺{^{{u׺{^{{u׺{^{{u׺{^{{u׺{^{{uʏ SwO=~ߴkYnmܶ>R':M K+{ߺ_$W{Ew"-S{7cfkc#WoٱQ((՚'o[BE]%uH>{{u׺{^{{u׺0^v7e-?пj)>0oIo +e{PHANr^{{u׺{^{{u׺{^{{u׺{^{{u׺{^{{u׺{^{{u׺{^{{u׺{^{{u׺{^{{u׺{^{{^~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽t͞{{j'nmErN,M#+5 :pxt~{Sldx<{uTGgɝ]b\oWto5:}7lTڿ~pv-")kꧫ:U" N#1DMi({[Ȍ/J}}b^QO.Ԣ?~?XlL>=[_km(ҷwdvCpYq3s*J={{^&B+A[YRTWRL_ʺ3+}ߺ_ޢ|d:ò^W+tUm(ծq~{{u׺}9۹jpW;fL/c|5QZJW׺)(&jZid'x 2:! }ߺ\**jj(h!JjJi4x::TA{u_緻>ja'w1VlLvz^znۮ{z 5/Z OƉjUq~{øﭿ3Ag|v~ەA,c~Sq~S ܐ9~|.z橩Zdyig2K4K3I$׺OOθb_:?lNm|.^G&۝uC)%%d.XdR